ASPH-aspartate beta-hydroxylase Gene View larger

ASPH-aspartate beta-hydroxylase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASPH-aspartate beta-hydroxylase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ASPH-aspartate beta-hydroxylase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066929
Product type: DNA & cDNA
Ncbi symbol: ASPH
Origin species: Human
Product name: ASPH-aspartate beta-hydroxylase Gene
Size: 2ug
Accessions: BC066929
Gene id: 444
Gene description: aspartate beta-hydroxylase
Synonyms: AAH; BAH; CASQ2BP1; FDLAB; HAAH; JCTN; junctin; aspartyl/asparaginyl beta-hydroxylase; A beta H-J-J; ASP beta-hydroxylase; cardiac junctin; humbug; junctate; peptide-aspartate beta-dioxygenase; aspartate beta-hydroxylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccagcgtaagaatgccaagagcagcggcaacagcagcagcagcggctccggcagcggtagcacgagtgcgggcagcagcagccccggggcccggagagagacaaagcatggaggacacaagaatgggaggaaaggcggactctcaggaacttcattcttcacgtggtttatggtgattgcattgctgggcgtctggacatctgtagctgtcgtttggtttgatcttgttgactatgaggaagttctagccaaagcaaaggacttccgttataacttatcagaggtgcttcaaggaaaactaggaatctatgatgctgatggtgatggagattttgatgtggatgatgccaaagttttattaggcctgaccaaagatggcagtaatgaaaatattgattctcttgaggaagtccttaatattttagcagaggaaagttcagattggttttatggtttcctctcatttctctatgatataatgactccttttgaaatgctagaagaagaagaagaagaaagcgaaaccgcagatggtgttgatggtacgtcacagaatgaaggggttcagggaaagacttgtgtcatattggatttacataaccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adenylate kinase 3-like 1
- diacylglycerol kinase, eta
- high-mobility group box 1
- prostaglandin reductase 2

Buy ASPH-aspartate beta-hydroxylase Gene now

Add to cart