UBL3-ubiquitin-like 3 Gene View larger

UBL3-ubiquitin-like 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBL3-ubiquitin-like 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBL3-ubiquitin-like 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC059385
Product type: DNA & cDNA
Ncbi symbol: UBL3
Origin species: Human
Product name: UBL3-ubiquitin-like 3 Gene
Size: 2ug
Accessions: BC059385
Gene id: 5412
Gene description: ubiquitin-like 3
Synonyms: HCG-1; PNSC1; ubiquitin-like protein 3; MUB; hsMUB; membrane-anchored ubiquitin-fold protein; protein HCG-1; ubiquitin like 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccagtaatgtcccggcggatatgataaatttgcgcctcattttggtaagcggaaaaacaaaagagttcctgttttctcctaacgattctgcttctgacattgcaaagcatgtatatgacaattggccaatggactgggaagaagagcaggtcagcagtccaaatattctacgacttatttatcaaggacgatttctacatggaaatgtcacattaggagcattaaaacttccttttggcaaaacaacagtgatgcatttggtggccagagagacattaccagagccaaactctcaaggtcagaggaatcgtgagaagactggagagagtaattgttgtgtaatcctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proline rich 13
- lysozyme-like 2
- forkhead box R2
- podocan-like 1

Buy UBL3-ubiquitin-like 3 Gene now

Add to cart