TMEM146-transmembrane protein 146 Gene View larger

TMEM146-transmembrane protein 146 Gene

PTXBC043005

New product

Data sheet of TMEM146-transmembrane protein 146 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM146-transmembrane protein 146 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC043005
Product type: DNA & cDNA
Ncbi symbol: TMEM146
Origin species: Human
Product name: TMEM146-transmembrane protein 146 Gene
Size: 2ug
Accessions: BC043005
Gene id: 257062
Gene description: transmembrane protein 146
Synonyms: TMEM146; cation channel sperm-associated protein subunit delta; catSper-delta; catSperdelta; catsper channel auxiliary subunit delta; transmembrane protein 146; cation channel sperm associated auxiliary subunit delta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggataactttgagactagtctccttccatttaccatccctacatcaatgcaggtcggcgtaccagaagtgacatcagcacattttgctggttcgttattgctgttagtagtggatcaaaaagtctatatttatgattatgaaaataattcttggagcatgtctttaggtataaaacaccctgttacacatgtctctggtgataattgttgttatactggaagtttgttttgtgtgcatgtcagtaatttggtttttgcatatttccgtggagatcagatatcccagacttatatatattattcaaatactgggggattcagtttttggaagtatcactatgacagacaggcagaaatcattgggtctttaggcggaatcttccactttttttctttgtcacaggttgcgatgcttgtagtgaatcaagggaagggcatgttcaagtactcagatcaccccctcaaccggagtttcgggctgtcttttgactataatgggactctagacatcctcatcgcccccggccagagaggcatcctgctcctatggtttgagaacagcctgttgttttcccataatgcaggtcagctcgtcgacaccgtccgggtgaaaaaaggagaccagaccttgttttcttccatttttgaagccaagatcaccatccacaacattgctgtcactgaaaatgaactggcagttataactcgggaggataatttgtattatggcaatctgggcatcgtgccaagttccataatcaaatttgcagaccaatacatctggtcagaagacgtggccctgatgttcaggagcccagggactctggaaatactgaccccactgcgtgacacagcctttccagcttttgatttccagaagtgcctcgtgaatatccaggcgcttctcatggaccctgaactccacgttggaaagtgcaagatagagtttctgacaggagaatttatatacaggatgtataccattgacatgcacagccagctggaattgactgcttcgttgataccccagccaggcacatccctgattcctctggtgatggtgagcaacccccactccctggggttccaggccaccttctacgagaacggttacacatcagatgggaacaccaagtacaaactggatattttcctaaaacagcagcagcactggggcaggaccgactccaacttcacttccagtttaaagaaagccaccatgtctaccttaactgtggacatagcaaacaaggaaatttcatgtgtggatatcaagccactgtcggcactgatttcagttggctgcgacctggataaaaagatcgtcatccagaacaaagtttccgcctgttccatgggcatcctggaccccttgaccctgcaagacaattacagcttcatcatcgagaaggaattctacgaccccggcttccaggggcagcagtcctccgaggacctgcacgtgttttactcctaccagcagctgggctgtcctctcctcgtctactatgacaccctatggaagcccgtggtggagctgtggcgaaaagacagtttccaggaggtcatcgacgccgagtatgtgttactggaggtgaacgggcagttctcatactcctattccctgacggcccagtcggccatgtgtacctcccagccgcagaactggaccaccatgataaaggaattcggggggcccttcttctggaacagagagaactatgtgagctgccacgaccccaacaacaatgcccctttgaggtggccagacgtccagtatcagatcttgggcggccggacagcaaaccagatcattttcggccacaatggcttttatgtcttctacatttcgatcgtggatccgtactacagctactgtcaactggagaccatctttagcatctacgtgtatggagcattccccgtgcagctggtctctgctggagtcgtcatcctactgatcatctccagcatcctggggtccgtttggctggcctacaagacccccaagctgctacgcacagcacgcggccgcaggatcaagaagtgtgcgacacagctgtgtaggagatgcaagacggtctgccagttcagggcctcagccacagccagggcaggcacagagcccccgggacgccaccgcactcctcacggaggcaggtctgaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, class VI, type 11B
- mediator complex subunit 22
- mirror-image polydactyly 1
- complement factor D (adipsin)

Buy TMEM146-transmembrane protein 146 Gene now

Add to cart