PTXBC045550
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045550 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf65 |
| Origin species: | Human |
| Product name: | C10orf65-chromosome 10 open reading frame 65 Gene |
| Size: | 2ug |
| Accessions: | BC045550 |
| Gene id: | 112817 |
| Gene description: | chromosome 10 open reading frame 65 |
| Synonyms: | C10orf65; DHDPS2; DHDPSL; HP3; NPL2; 4-hydroxy-2-oxoglutarate aldolase, mitochondrial; DHDPS-like protein; N-acetylneuraminate pyruvate lyase 2 (putative); dihydrodipicolinate synthase-like, mitochondrial; dihydrodipicolinate synthetase homolog 2; protein 569272; 4-hydroxy-2-oxoglutarate aldolase 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgggtccccaagtctggtcttctgtgaggcaggggctaagcaggagcttgtccaggaatgtgggggtctgggcctcaggggaggggaagaaggtggacattgcgggtatctacccccctgtgaccacccccttcactgccactgcagaggtggactatgggaaactggaggagaatctgcacaaactgggcaccttccccttccgaggcttcgtggtccagggctccaatggcgagtttcctttcctgaccagcagtgagcgcctcgaggtggtgagccgtgtgcgccaggccatgcccaagaacaggctcctgctagctggctccggatgcgagtccactcaagccacagtggagatgaccgtcagcatggcccaggtcggggctgacgcggccatggtggtgaccccttgctactatcgtggccgcatgagcagtgcggccctcattcaccactacaccaaggttgctgatctctctccaatccctgtggtgctgtacagtgtcccagccaacacagggctggacctgcctgtggatgcagtggtcacgctttcccagcacccgaatattgtgggcatgaaggacagcggtggtgatgtgaccaggattgggctgattgttcacaagaccaggaagcaggattttcaggtgttggctggatcggctggctttctgatggccagctatgccttgggagctgtggggggcgtctgcgccctggccaatgtcctgggggctcaggtgtgccagctggagcgactgtgctgcacggggcaatgggaagatgcccagaaactgcagcaccgcctcattgagccaaacgctgcggtgacccggcgctttgggatcccagggctgaagaaaatcatggactggtttggctactatggaggcccctgccgcgcacccttgcaggagctgagccccgctgaggaggaggcactgcgcatggatttcaccagcaacggctggctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - WD repeat and FYVE domain containing 1 - component of oligomeric golgi complex 3 - zinc finger protein 91 homolog (mouse) - chromosome 6 open reading frame 146 |