Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PLAC1L-placenta-specific 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLAC1L-placenta-specific 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036256 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLAC1L |
| Origin species: | Human |
| Product name: | PLAC1L-placenta-specific 1-like Gene |
| Size: | 2ug |
| Accessions: | BC036256 |
| Gene id: | 219990 |
| Gene description: | placenta-specific 1-like |
| Synonyms: | PLAC1L; TMEM122; oocyte-secreted protein 2; placenta-specific 1-like protein; testicular tissue protein Li 142; transmembrane protein 122; oocyte secreted protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgttagaagtcttgatgctcctcgctgtcttgatttggaccggtgctgagaacctccatgtgaaaataagttgctctctggactggttgatggtctcagttatcccagttgcagaaagcagaaatctgtatatatttgcggatgaattacatctgggaatgggctgccctgcaaatcggatacatacatatgtatatgagtttatatatcttgttcgtgattgtggcatcaggacaagggtagtttctgaggaaactctcctttttcaaaccgagctgtactttaccccaaggaatatagatcatgaccctcaggaaatccatttggagtgttccacctctaggaaatcagtgtggcttacaccagtttctactgagaatgaaataaaattggatcctagtccttttattgctgactttcagacaacagcagaagagttaggattattatcttctagtccaaacttgctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrosomal protein 57kDa - transmembrane protein 17 - glycine receptor, alpha 2 - kelch-like 7 (Drosophila) |