Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of REG3A-regenerating islet-derived 3 alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about REG3A-regenerating islet-derived 3 alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036776 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | REG3A |
| Origin species: | Human |
| Product name: | REG3A-regenerating islet-derived 3 alpha Gene |
| Size: | 2ug |
| Accessions: | BC036776 |
| Gene id: | 5068 |
| Gene description: | regenerating islet-derived 3 alpha |
| Synonyms: | HIP; HIP/PAP; INGAP; PAP; PAP-H; PAP1; PBCGF; REG-III; REG3; regenerating islet-derived protein 3-alpha; PAP homologous protein; REG-3-alpha; hepatocarcinoma-intestine-pancreas; hepatointestinal pancreatic protein; human proislet peptide; pancreatic beta cell growth factor; pancreatitis-associated protein 1; proliferation-inducing protein 34; proliferation-inducing protein 42; reg III-alpha; regenerating islet-derived 3 alpha; regenerating islet-derived protein III-alpha; regenerating family member 3 alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcctcccatggccctgcccagtgtatcttggatgctgctttcctgcctcatgctgctgtctcaggttcaaggtgaagaaccccagagggaactgccctctgcacggatccgctgtcccaaaggctccaaggcctatggctcccactgctatgccttgtttttgtcaccaaaatcctggacagatgcagatctggcctgccagaagcggccctctggaaacctggtgtctgtgctcagtggggctgagggatccttcgtgtcctccctggtgaagagcattggtaacagctactcatacgtctggattgggctccatgaccccacacagggcaccgagcccaatggagaaggttgggagtggagtagcagtgatgtgatgaattactttgcatgggagagaaatccctccaccatctcaagccccggccactgtgcgagcctgtcgagaagcacagcatttctgaggtggaaagattataactgtaatgtgaggttaccctatgtctgcaagttcactgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 3B - chemokine (C-X-C motif) ligand 16 - RAB15, member RAS onocogene family - gap junction protein, beta 7, 25kDa |