Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHOC-ras homolog gene family, member C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHOC-ras homolog gene family, member C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007245 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHOC |
| Origin species: | Human |
| Product name: | RHOC-ras homolog gene family, member C Gene |
| Size: | 2ug |
| Accessions: | BC007245 |
| Gene id: | 389 |
| Gene description: | ras homolog gene family, member C |
| Synonyms: | small GTP binding protein RhoC; rhoC GTPase; rho-related GTP-binding protein RhoC; ARH9; ARHC; RHOH9; RAS-related homolog 9; oncogene RHO H9; ras homolog gene family, member C; rho cDNA clone 9; ras homolog family member C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcaatccgaaagaagctggtgatcgttggggatggtgcctgtgggaagacctgcctcctcatcgtcttcagcaaggatcagtttccggaggtctacgtccctactgtctttgagaactatattgcggacattgaggtggacggcaagcaggtggagctggctctgtgggacacagcagggcaggaagactatgatcgactgcggcctctctcctacccggacactgatgtcatcctcatgtgcttctccatcgacagccctgacagcctggaaaacattcctgagaagtggaccccagaggtgaagcacttctgccccaacgtgcccatcatcctggtggggaataagaaggacctgaggcaagacgagcacaccaggagagagctggccaagatgaagcaggagcccgttcggtctgaggaaggccgggacatggcgaaccggatcagtgcctttggctaccttgagtgctcagccaagaccaaggagggagtgcgggaggtgtttgagatggccactcgggctggcctccaggtccgcaagaacaagcgtcggaggggctgtcccattctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - T cell receptor delta variable 2 - coactosin-like 1 (Dictyostelium) - blood vessel epicardial substance - zona pellucida binding protein 2 |