HLA-F-major histocompatibility complex, class I, F Gene View larger

HLA-F-major histocompatibility complex, class I, F Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-F-major histocompatibility complex, class I, F Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-F-major histocompatibility complex, class I, F Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009260
Product type: DNA & cDNA
Ncbi symbol: HLA-F
Origin species: Human
Product name: HLA-F-major histocompatibility complex, class I, F Gene
Size: 2ug
Accessions: BC009260
Gene id: 3134
Gene description: major histocompatibility complex, class I, F
Synonyms: CDA12; HLA-5.4; HLA-CDA12; HLAF; HLA class I histocompatibility antigen, alpha chain F; HLA F antigen; MHC class I antigen F; leukocyte antigen F; major histocompatibility complex, class I, F
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgccccgaagcctcctcctgctgctctcaggggccctggccctgaccgatacttgggcaggctcccactccttgaggtatttcagcaccgctgtgtcgcggcccggccgcggggagccccgctacatcgccgtggagtacgtagacgacacgcaattcctgcggttcgacagcgacgccgcgattccgaggatggagccgcgggagccgtgggtggagcaagaggggccgcagtattgggagtggaccacagggtacgccaaggccaacgcacagactgaccgagtggccctgaggaacctgctccgccgctacaaccagagcgaggctgggtctcacaccctccagggaatgaatggctgcgacatggggcccgacggacgcctcctccgcgggtatcaccagcacgcgtacgacggcaaggattacatctccctgaacgaggacctgcgctcctggaccgcggcggacaccgtggctcagatcacccagcgcttctatgaggcagaggaatatgcagaggagttcaggacctacctggagggcgagtgcctggagttgctccgcagatacttggagaatgggaaggagacgctacagcgcgcagatcctccaaaggcacacgttgcccaccaccccatctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacgctgacctggcagcgggatggggaggaacagacccaggacacagagcttgtggagaccaggcctgcaggggatggaaccttccagaagtgggccgctgtggtggtgccttctggagaggaacagagatacacatgccatgtgcagcacgaggggctgccccagcccctcatcctgagatgggagcagtctccccagcccaccatccccatcgtgggcatcgttgctggccttgttgtccttggagctgtggtcactggagctgtggtcgctgctgtgatgtggaggaagaagagctcagatagaaacagagggagctactctcaggctgcagcctactcagtggtcagcggactcttgatgataacatggtggtcaagcttatttctcctgggggtgctcttccaaggatatttgggctgcctccggagtcacagtgtcttgggccgccggaaggtgggtgacatgtggatcttgttttttttgtggctgtggacatctttcaacactgccttcttggccttgcaaagccttcgctttggcttcggctttaggaggggcaggagcttccttcttcgttcttggcaccatcttatgaaaagggtccagattaagatttttgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily C, member 4
- preferentially expressed antigen in melanoma
- mitochondrial carrier homolog 1 (C. elegans)
- melanoma inhibitory activity family, member 3

Buy HLA-F-major histocompatibility complex, class I, F Gene now

Add to cart