KIAA0415-KIAA0415 Gene View larger

KIAA0415-KIAA0415 Gene

PTXBC037399

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA0415-KIAA0415 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA0415-KIAA0415 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037399
Product type: DNA & cDNA
Ncbi symbol: KIAA0415
Origin species: Human
Product name: KIAA0415-KIAA0415 Gene
Size: 2ug
Accessions: BC037399
Gene id: 9907
Gene description: KIAA0415
Synonyms: KIAA0415; SPG48; zeta; AP-5 complex subunit zeta-1; adapter-related protein complex 5 zeta subunit; adaptor-related protein complex 5 zeta subunit; zeta5; adaptor related protein complex 5 zeta 1 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaaggtcgtggtcctcagcccgggcaccctccaggaggaccaggccaccctgctcagcaagcggctggtcgactggctgcgctacgccagcctccagcaagggctcccacactccggcggcttcttctccacgcccagggcccggcagccgggccccgtcaccgaggtggacggggcggtagccacagacttcttcacggtgctctccagcggccaccgcttcacagacgaccagtggctgaacgtgcaggccttctctatgctgcgggcgtggctgctgcacagcggccccgagggcccgggcaccctggacacagatgacaggtcagagcaggagggctccactctgtcggtgatctccgccacctcctctgccggccgcctgctgccgccccgggagcggcttcgggaggtggccttcgagtactgccagcgcctcattgagcaaagtaaccgacgagccctgaggaagggggactccgacctgcagaaagcttgcctggtggaggccgtgctggtgctggacgtgctgtgccggcaggacccgtccttcctgtaccgaagtctctcctgcctgaaggccctgcacgggcgggtgcgcggggacccggcctctgtgcgggtgctgctgcccctcgcccacttcttcctgagccacggggaagcggctgcagtggactcggaagccgtctaccagcacctgttcaccaggatcccggtggagcagttccacagccccatgctggcctttgaattcatccagttctgcagggacaacctccacctgttcagcgggcacctcagcaccctcagattgagcttccccaacctctttaagttcctggcctggaacagcccacccctcacctccgagtttgtggcgctcctcccggccctggtggacgctggcacagccctggagatgctgcacgcgctgctggacctgccctgcttgacggcggtgctggacctgcagctcaggtcagcaccggctgcatccgagaggccactctgggacacctctctcagggcccccagctgcctggaggccttccgggacccgcagttccagggtcttttccaatacctgctgcgccccaaggccagtggcgccactgagaggttggcgccactccaccagctgctgcagcccatggccggctgtgcccgcgtggcccagtgtgcccaggccgtgcccacgctgctgcaggcattcttctcagcagtgacccaggtggctgacgggtccctgatcaaccagctggcgctgctgctcctgggcaggagcgactcgctctacccggccccagggtacgctgccggtgtgcacaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA0141
- melanophilin
- KIAA1217
- contactin 1

Buy KIAA0415-KIAA0415 Gene now

Add to cart