AGA-aspartylglucosaminidase Gene View larger

AGA-aspartylglucosaminidase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGA-aspartylglucosaminidase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AGA-aspartylglucosaminidase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012392
Product type: DNA & cDNA
Ncbi symbol: AGA
Origin species: Human
Product name: AGA-aspartylglucosaminidase Gene
Size: 2ug
Accessions: BC012392
Gene id: 175
Gene description: aspartylglucosaminidase
Synonyms: AGU; ASRG; N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase; N4-(N-acetyl-beta-glucosaminyl)-L-asparagine amidase; aspartylglucosylamine deaspartylase; glycosylasparaginase; aspartylglucosaminidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcggaagtcgaacttgcctgtgcttctcgtgccgtttctgctctgccaggccctagtgcgctgctccagccctctgcccctggtcgtcaacacttggccctttaagaatgcaaccgaagcagcgtggagggcattagcatctggaggctctgccctggatgcagtggagagcggctgtgccatgtgtgagagagagcagtgtgacggctctgtaggctttggaggaagtcctgatgaacttggagaaaccacactagatgccatgatcatggatggcactactatggatgtaggagcagtaggagatctcagacgaattaaaaatgctattggtgtggcacggaaagtactggaacatacaacacacacacttttagtaggagagtcagccaccacatttgctcaaagtatggggtttatcaatgaagacttatctaccagtgcttctcaagctcttcattcagattggcttgctcggaattgccagccaaattattggaggaatgttataccagatccctcaaaatactgcggaccctacaaaccacctggtatcttaaagcaggatattcctatccataaagaaacagaagatgatcgtggtcatgacactattggcatggttgtaatccataagacaggacatattgctgctggtacatctacaaatggtataaaattcaaaatacatggccgtgtaggagactcaccaatacctggagctggagcctatgctgacgatactgcaggggcagccgcagccactgggaatggtgatatattgatgcgcttcctgccaagctaccaagctgtagaatacatgagaagaggagaagatccaaccatagcttgccaaaaagtgatttcaagaatccagaagcattttccagaattctttggggctgttatatgtgccaatgtgactggaagttacggtgctgcttgcaataaactttcaacatttactcagtttagtttcatggtttataattccgaaaaaaatcagccaactgaggaaaaagtggactgcatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - creatine kinase, muscle
- silver homolog (mouse)
- ribosomal protein L30
- embigin homolog (mouse)

Buy AGA-aspartylglucosaminidase Gene now

Add to cart