TUBB6-tubulin, beta 6 Gene View larger

TUBB6-tubulin, beta 6 Gene

PTXBC002654

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TUBB6-tubulin, beta 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TUBB6-tubulin, beta 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002654
Product type: DNA & cDNA
Ncbi symbol: TUBB6
Origin species: Human
Product name: TUBB6-tubulin, beta 6 Gene
Size: 2ug
Accessions: BC002654
Gene id: 84617
Gene description: tubulin, beta 6
Synonyms: HsT1601; TUBB-5; tubulin beta-6 chain; class V beta-tubulin; tubulin beta MGC4083; tubulin beta class V; tubulin, beta 6; tubulin beta 6 class V
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggagatcgtgcacatccaggcgggccagtgcgggaaccagatcggcaccaagttttgggaagtgatcagcgatgagcacggcatcgacccggccggaggctacgtgggagactcggcgctgcagctggagagaatcaacgtctactacaatgagtcatcgtctcagaaatatgtgcccagggccgccctggtggacttagagccaggcaccatggacagcgtgcggtctgggccttttgggcagcttttccggcctgacaacttcatctttggccagacgggtgcagggaacaactgggcgaaagggcactacacggagggcgcggagctggtggacgcagtgctggacgtggtgcggaaggagtgcgagcactgcgactgcctgcagggcttccagctcacgcactcgctgggcggcggcacgggctcaggcatgggcacgctgctcatcagcaagatccgtgaggagttcccggaccgcatcatgaacaccttcagcgtcatgccctcgcccaaggtgtcggacacggtggtggagccctacaatgccacactgtcggtgcaccagctggtggagaatacagacgagacctactgcatcgacaacgaggcgctctatgacatctgcttccgcactctgaagctgacaacgcccacctacggggacctcaaccacctggtgtccgccaccatgagtggggtcaccacctcgctgcgcttcccgggccagctcaatgctgacctgcgcaagctggcggtgaacatggtgcccttcccgcgcctgcacttcttcatgcctggcttcgcgccgctcaccagccgcggcagccagcagtaccgggccctgaccgtgcccgagctcacccagcagatgttcgacgccaggaacatgatggccgcctgcgatccgcgccatggccgctacctgaccgtggccaccgtgttccgcgggcccatgtccatgaaggaggtggacgagcagatgctggccatccagagtaagaacagcagctacttcgtggagtggattcccaacaacgtgaaggtggccgtgtgcgacatcccgccccgcggcctgaagatggcctccaccttcatcggcaacagcacggccatccaggagctgttcaagcgcatctccgagcagttctcagccatgttccggcgcaaggccttcctgcactggttcacgggtgagggcatggatgaaatggagttcaccgaggcggagagcaacatgaacgacctggtatccgagtaccagcagtaccaggatgccaccgccaatgacggggaggaagcttttgaggatgaggaagaggagatcgatggatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box protein 9
- proline rich 16
- neurexophilin 1
- F-box protein 4

Buy TUBB6-tubulin, beta 6 Gene now

Add to cart