Login to display prices
Login to display prices
PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene View larger

PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene

PTXBC003619

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene

Proteogenix catalog: PTXBC003619
Ncbi symbol: PSMG1
Product name: PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene
Size: 2ug
Accessions: BC003619
Gene id: 8624
Gene description: proteasome (prosome, macropain) assembly chaperone 1
Synonyms: C21LRP; DSCR2; LRPC21; PAC-1; PAC1; proteasome assembly chaperone 1; Down syndrome critical region gene 2; Down syndrome critical region protein 2; chromosome 21 leucine-rich protein; leucine rich protein C21-LRP; proteasome (prosome, macropain) assembly chaperone 1; proteasome assembling chaperone 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccacgttcttcggagaggtggtgaaggcgccgtgccgagctgggactgaggacgaagaggaggaggaggaggggcggagggagacgcccgaggacagggaggtgcgtctgcagctggcgcggaagagggaagtgcggctccttcgaagacaaacaaaaacatctttggaagtttctttgctagaaaaatatccgtgctccaagtttataattgctataggaaataatgcagtagcatttctgtcatcatttgttatgaattcaggagtctgggaggaagttggttgtgctaaactctggaatgaatggtgtagaacaacagacactacacatctgtcctccacagaggctttttgtgtgttttatcatctaaaatccaatccctcggtttttctctgtcagtgcagttgctatgttgcagaagatcaacagtatcagtggctggaaaaggtttttggctcttgtccaaggaagaacatgcagataactattctcacatgtcgacatgttaccgattataaaacctcagaatccaccggcagccttccttctcctttcctgagagccctaaaaacacagaatttcaaagactcggcgtgttgtccattgctagaacaaccgaatatagtacacgaccttcctgcagcagttctaagctactgtcaagtatggaaaatcccggcaattctgtacttgtgttatactgatgtgatgaaattagacctaatcacagtggaagcttttaagcctatactttctaccagaagcttgaagggtttggttaagaatattccccaaagcactgagatactaaagaaattgatgacaacaaatgagattcagagtaacatttatacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: