PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene View larger

PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003619
Product type: DNA & cDNA
Ncbi symbol: PSMG1
Origin species: Human
Product name: PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene
Size: 2ug
Accessions: BC003619
Gene id: 8624
Gene description: proteasome (prosome, macropain) assembly chaperone 1
Synonyms: C21LRP; DSCR2; LRPC21; PAC-1; PAC1; proteasome assembly chaperone 1; Down syndrome critical region gene 2; Down syndrome critical region protein 2; chromosome 21 leucine-rich protein; leucine rich protein C21-LRP; proteasome (prosome, macropain) assembly chaperone 1; proteasome assembling chaperone 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccacgttcttcggagaggtggtgaaggcgccgtgccgagctgggactgaggacgaagaggaggaggaggaggggcggagggagacgcccgaggacagggaggtgcgtctgcagctggcgcggaagagggaagtgcggctccttcgaagacaaacaaaaacatctttggaagtttctttgctagaaaaatatccgtgctccaagtttataattgctataggaaataatgcagtagcatttctgtcatcatttgttatgaattcaggagtctgggaggaagttggttgtgctaaactctggaatgaatggtgtagaacaacagacactacacatctgtcctccacagaggctttttgtgtgttttatcatctaaaatccaatccctcggtttttctctgtcagtgcagttgctatgttgcagaagatcaacagtatcagtggctggaaaaggtttttggctcttgtccaaggaagaacatgcagataactattctcacatgtcgacatgttaccgattataaaacctcagaatccaccggcagccttccttctcctttcctgagagccctaaaaacacagaatttcaaagactcggcgtgttgtccattgctagaacaaccgaatatagtacacgaccttcctgcagcagttctaagctactgtcaagtatggaaaatcccggcaattctgtacttgtgttatactgatgtgatgaaattagacctaatcacagtggaagcttttaagcctatactttctaccagaagcttgaagggtttggttaagaatattccccaaagcactgagatactaaagaaattgatgacaacaaatgagattcagagtaacatttatacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcium channel, voltage-dependent, gamma subunit 3
- purinergic receptor P2X, ligand-gated ion channel, 5
- janus kinase and microtubule interacting protein 1
- purinergic receptor P2X, ligand-gated ion channel, 1

Buy PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene now

Add to cart