Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene
PTXBC003619
New product
Data sheet of PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003619 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMG1 |
| Origin species: | Human |
| Product name: | PSMG1-proteasome (prosome, macropain) assembly chaperone 1 Gene |
| Size: | 2ug |
| Accessions: | BC003619 |
| Gene id: | 8624 |
| Gene description: | proteasome (prosome, macropain) assembly chaperone 1 |
| Synonyms: | C21LRP; DSCR2; LRPC21; PAC-1; PAC1; proteasome assembly chaperone 1; Down syndrome critical region gene 2; Down syndrome critical region protein 2; chromosome 21 leucine-rich protein; leucine rich protein C21-LRP; proteasome (prosome, macropain) assembly chaperone 1; proteasome assembling chaperone 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccacgttcttcggagaggtggtgaaggcgccgtgccgagctgggactgaggacgaagaggaggaggaggaggggcggagggagacgcccgaggacagggaggtgcgtctgcagctggcgcggaagagggaagtgcggctccttcgaagacaaacaaaaacatctttggaagtttctttgctagaaaaatatccgtgctccaagtttataattgctataggaaataatgcagtagcatttctgtcatcatttgttatgaattcaggagtctgggaggaagttggttgtgctaaactctggaatgaatggtgtagaacaacagacactacacatctgtcctccacagaggctttttgtgtgttttatcatctaaaatccaatccctcggtttttctctgtcagtgcagttgctatgttgcagaagatcaacagtatcagtggctggaaaaggtttttggctcttgtccaaggaagaacatgcagataactattctcacatgtcgacatgttaccgattataaaacctcagaatccaccggcagccttccttctcctttcctgagagccctaaaaacacagaatttcaaagactcggcgtgttgtccattgctagaacaaccgaatatagtacacgaccttcctgcagcagttctaagctactgtcaagtatggaaaatcccggcaattctgtacttgtgttatactgatgtgatgaaattagacctaatcacagtggaagcttttaagcctatactttctaccagaagcttgaagggtttggttaagaatattccccaaagcactgagatactaaagaaattgatgacaacaaatgagattcagagtaacatttatacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium channel, voltage-dependent, gamma subunit 3 - purinergic receptor P2X, ligand-gated ion channel, 5 - janus kinase and microtubule interacting protein 1 - purinergic receptor P2X, ligand-gated ion channel, 1 |