Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CBR1-carbonyl reductase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CBR1-carbonyl reductase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002511 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CBR1 |
| Origin species: | Human |
| Product name: | CBR1-carbonyl reductase 1 Gene |
| Size: | 2ug |
| Accessions: | BC002511 |
| Gene id: | 873 |
| Gene description: | carbonyl reductase 1 |
| Synonyms: | CBR; SDR21C1; hCBR1; carbonyl reductase [NADPH] 1; 15-hydroxyprostaglandin dehydrogenase; NADPH-dependent carbonyl reductase 1; carbonyl reductase (NADPH) 1; prostaglandin 9-ketoreductase; prostaglandin-E(2) 9-reductase; short chain dehydrogenase/reductase family 21C member 1; carbonyl reductase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtccggcatccatgtagcgctggtgactggaggcaacaagggcatcggcttggccatcgtgcgcgacctgtgccggctgttctcgggggacgtggtgctcacggcgcgggacgtgacgcggggccaggcggccgtacagcagctgcaggcggagggcctgagcccgcgcttccaccagctggacatcgacgatctgcagagcatccgcgccctgcgcgacttcctgcgcaaggagtacgggggcctggacgtgctggtcaacaacgcgggcatcgccttcaaggttgctgatcccacaccctttcatattcaagctgaagtgacgatgaaaacaaatttctttggtacccgagatgtgtgcacagaattactccctctaataaaaccccaagggagagtggtgaacgtatctagcatcatgagcgtcagagcccttaaaagctgcagcccagagctgcagcagaagttccgcagtgagaccatcactgaggaggagctggtggggctcatgaacaagtttgtggaggatacaaagaagggagtgcaccagaaggagggctggcccagcagcgcatacggggtgacgaagattggcgtcaccgttctgtccaggatccacgccaggaaactgagtgagcagaggaaaggggacaagatcctcctgaatgcctgctgcccagggtgggtgagaactgacatggcgggacccaaggccaccaagagcccagaagaaggtgcagagacccctgtgtacttggcccttttgcccccagatgctgagggtccccatggacaatttgtttcagagaagagagttgaacagtggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein S2 - ets homologous factor - carbonic anhydrase IV - WD repeat domain 75 |