Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LMOD1-leiomodin 1 (smooth muscle) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LMOD1-leiomodin 1 (smooth muscle) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001755 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LMOD1 |
| Origin species: | Human |
| Product name: | LMOD1-leiomodin 1 (smooth muscle) Gene |
| Size: | 2ug |
| Accessions: | BC001755 |
| Gene id: | 25802 |
| Gene description: | leiomodin 1 (smooth muscle) |
| Synonyms: | 64kD; SM-LMOD; SMLMOD; leiomodin-1; 64 kDa autoantigen 1D; 64 kDa autoantigen 1D3; 64 kDa autoantigen D1; leimodin 1 (smooth muscle); leiomodin 1 (smooth muscle); leiomodin, muscle form; smooth muscle leiomodin; thyroid and eye muscle autoantigen D1 (64kD); thyroid-associated ophthalmopathy autoantigen; leiomodin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagctggagaaggagctggacgtggtggacccagacgggagtgttcccgtggggctgcggcagagaaaccagacggagaaacagtccacgggtgtgtacaaccgggaggccatgctcaacttctgtgaaaaggagaccaagaaacttatgcagagggagatgtccatggatgaaagcaagcaagtggagaccaagacagatgccaagaatggagaggaaaggggcagagatgccagcaaaaaagccctgggccccagacgggactcagatctggggaaggagccaaagaggggtggtttaaagaaaagcttctctagagacagagatgaagctggtggcaagagtggcgagaagcccaaggaggagaagatcatccggggcattgacaagggccgggtcagggctgcagtggataagaaggaggcagggaaggatgggagaggagaggagagggcagtggccaccaagaaggaagaggagaagaaagggagtgacaggaacacaggcttgagcagggacaaggataaaaagagagaggagatgaaggaggtggccaagaaagaggatgatgagaaggtaaaagggggtgctccagctgccccaccaccccctccccctcccttggctccaccccttatcatggagaacctgaagaattcactctcaccagctacccagaggaagatgggagacaaagtcctccctgcccaggagaagaactcccgtgaccagctattggctgccatccgctccagcaacctcaagcagctcaagaaggtggaagtgcccaaactgcttcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 103 - transmembrane protein 38B - collagen, type II, alpha 1 - transmembrane protein 171 |