Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMED9-transmembrane emp24 protein transport domain containing 9 Gene
PTXBC001123
New product
Data sheet of TMED9-transmembrane emp24 protein transport domain containing 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED9-transmembrane emp24 protein transport domain containing 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001123 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED9 |
| Origin species: | Human |
| Product name: | TMED9-transmembrane emp24 protein transport domain containing 9 Gene |
| Size: | 2ug |
| Accessions: | BC001123 |
| Gene id: | 54732 |
| Gene description: | transmembrane emp24 protein transport domain containing 9 |
| Synonyms: | GMP25; HSGP25L2G; p24a2; p24alpha2; p25; transmembrane emp24 domain-containing protein 9; glycoprotein 25L2; p24 family protein alpha-2; transmembrane emp24 protein transport domain containing 9; transmembrane p24 trafficking protein 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtggagctgggcgtgctgctcgtccggccccggcccggaaccgggctgggtagagtgatgcggaccctcctgctggtgctgtggctggcgacgcgcggaagcgcgctctactttcacatcggagagacggagaagaagtgctttattgaggagatcccggacgagaccatggtcataggaaactaccggacgcagctgtatgacaagcagcgggaggagtaccagccggccaccccggggcttggcatgtttgtggaggtgaaggacccagaggacaaggtcatcctggcccggcagtatggctccgagggcaggttcactttcacttcccatacccctggtgagcaccagatctgtcttcactccaattccaccaagttctccctctttgctggaggcatgctgagagttcacctggacatccaggtaggtgaacatgccaatgactatgcagaaattgctgctaaagacaagttgagtgagttgcagctacgagtgcgacagctggtggaacaagtggagcagatccagaaagagcagaactaccagcggtggcgagaggagcgcttccggcagaccagtgagagcaccaaccagcgggtgctgtggtggtccattctgcagaccctcatcctcgtggccatcggtgtctggcagatgcggcacctcaagagcttctttgaagccaagaagcttgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1D magnesium-dependent, delta isoform - protein phosphatase 1D magnesium-dependent, delta isoform - neuroblastoma breakpoint family, member 22 (pseudogene) - chorionic somatomammotropin hormone 1 (placental lactogen) |