Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FADD-Fas (TNFRSF6)-associated via death domain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FADD-Fas (TNFRSF6)-associated via death domain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000334 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FADD |
| Origin species: | Human |
| Product name: | FADD-Fas (TNFRSF6)-associated via death domain Gene |
| Size: | 2ug |
| Accessions: | BC000334 |
| Gene id: | 8772 |
| Gene description: | Fas (TNFRSF6)-associated via death domain |
| Synonyms: | GIG3; MORT1; FAS-associated death domain protein; Fas (TNFRSF6)-associated via death domain; Fas-associating death domain-containing protein; Fas-associating protein with death domain; growth-inhibiting gene 3 protein; mediator of receptor-induced toxicity; Fas associated via death domain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccgttcctggtgctgctgcactcggtgtcgtccagcctgtcgagcagcgagctgaccgagctcaagttcctatgcctcgggcgcgtgggcaagcgcaagctggagcgcgtgcagagcggcctagacctcttctccatgctgctggagcagaacgacctggagcccgggcacaccgagctcctgcgcgagctgctcgcctccctgcggcgccacgacctgctgcggcgcgtcgacgacttcgaggcgggggcggcggccggggccgcgcctggggaagaagacctgtgtgcagcatttaacgtcatatgtgataatgtggggaaagattggagaaggctggctcgtcagctcaaagtctcagacaccaagatcgacagcatcgaggacagatacccccgcaacctgacagagcgtgtgcgggagtcactgagaatctggaagaacacagagaaggagaacgcaacagtggcccacctggtgggggctctcaggtcctgccagatgaacctggtggctgacctggtacaagaggttcagcaggcccgtgacctccagaacaggagtggggccatgtccccgatgtcatggaactcagacgcatctacctccgaagcgtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, CCHC domain containing 24 - methyltransferase 10 domain containing - glutaminyl-peptide cyclotransferase-like - chromosome 20 open reading frame 195 |