Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C21orf7-chromosome 21 open reading frame 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C21orf7-chromosome 21 open reading frame 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008567 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C21orf7 |
| Origin species: | Human |
| Product name: | C21orf7-chromosome 21 open reading frame 7 Gene |
| Size: | 2ug |
| Accessions: | BC008567 |
| Gene id: | 56911 |
| Gene description: | chromosome 21 open reading frame 7 |
| Synonyms: | C21orf7; HC21ORF7; TAK1L; TAKL; TAKL-1; TAKL-2; TAKL-4; MAP3K7 C-terminal-like protein; TAK1-like protein 1; TAK1-like protein 2; TAK1-like protein 4; TGF-beta activated kinase; MAP3K7 C-terminal like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcagcacagccagggtacctgctgacaagcctgtacgcatcgcctttagcctcaatgacgcctcagatgatacaccccctgaagactccattcctttggtctttccagaattagaccagcagctacagcccctgccgccttgtcatgactccgaggaatccatggaggtgttcaaacagcactgccaaatagcagaagaataccatgaggtcaaaaaggaaatcaccctgcttgagcaaaggaagaaggagctcattgccaagttagatcaggcagaaaaggagaaggtggatgctgctgagctggttcgggaattcgaggctctgacggaggagaatcggacgttgaggttggcccagtctcaatgtgtggaacaactggagaaacttcgaatacagtatcagaagaggcagggctcgtcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome X open reading frame 26 - chromosome 5 open reading frame 40 - 5'-nucleotidase domain containing 1 - zinc finger CCCH-type containing 14 |