PTXBC034614
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC034614 |
Product type: | DNA & cDNA |
Ncbi symbol: | BOC |
Origin species: | Human |
Product name: | BOC-Boc homolog (mouse) Gene |
Size: | 2ug |
Accessions: | BC034614 |
Gene id: | 91653 |
Gene description: | Boc homolog (mouse) |
Synonyms: | BOC cell adhesion associated, oncogene regulated; Boc homolog; CDON2; brother of CDO; brother of CDON; cell adhesion associated, oncogene regulated 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgctgcgtgggacgatgacggcgtggagaggaatgaggcctgaggtcacactggcttgcctcctcctagccacagcaggctgctttgctgacttgaacgaggtccctcaggtcaccgtccagcctgcgtccaccgtccagaagcccggaggcactgtgatcttgggctgcgtggtggaacctccaaggatgaatgtaacctggcgcctgaatggaaaggagctgaatggctcggatgatgctctgggtgtcctcatcacccacgggaccctcgtcatcactgcccttaacaaccacactgtgggacggtaccagtgtgtggcccggatgcctgcgggggctgtggccagcgtgccagccactgtgacactagccagtgagtctgctcctttgcctccctgccatggtgcggtccctcctcatctctcccaccctgaagcccccaccattcatgctgcctcttgttactcttag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ribonuclease T2 - protocadherin 20 - F-box protein 22 - ubiquitin-like 4A |