Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IFI6-interferon, alpha-inducible protein 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFI6-interferon, alpha-inducible protein 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011601 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFI6 |
| Origin species: | Human |
| Product name: | IFI6-interferon, alpha-inducible protein 6 Gene |
| Size: | 2ug |
| Accessions: | BC011601 |
| Gene id: | 2537 |
| Gene description: | interferon, alpha-inducible protein 6 |
| Synonyms: | FAM14C; G1P3; IFI-6-16; IFI616; interferon alpha-inducible protein 6; interferon, alpha-inducible protein clone IFI-6-16; interferon-induced protein 6-16; interferon alpha inducible protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcagaaggcggtatcgcttttcttgtgctacctgctgctcttcacttgcagtggggtggaggcaggtaagaaaaagtgctcggagagctcggacagcggctccgggttctggaaggccctgaccttcatggccgtcggaggaggactcgcagtcgccgggctgcccgcgctgggcttcaccggcgccggcatcgcggccaactcggtggctgcctcgctgatgagctggtctgcgatcctgaatgggggcggcgtgcccgccggggggctagtggccacgctgcagagcctcggggctggtggcagcagcgtcgtcataggtaatattggtgccctgatgggctacgccacccacaagtatctcgatagtgaggaggatgaggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lymphocyte antigen 6 complex, locus H - mitochondrial ribosomal protein L27 - chromosome 3 open reading frame 22 - chromosome 3 open reading frame 52 |