PFDN1-prefoldin subunit 1 Gene View larger

PFDN1-prefoldin subunit 1 Gene

PTXBC011869

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PFDN1-prefoldin subunit 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PFDN1-prefoldin subunit 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011869
Product type: DNA & cDNA
Ncbi symbol: PFDN1
Origin species: Human
Product name: PFDN1-prefoldin subunit 1 Gene
Size: 2ug
Accessions: BC011869
Gene id: 5201
Gene description: prefoldin subunit 1
Synonyms: PDF; PFD1; prefoldin subunit 1; prefoldin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcccccgtggatctagagctgaagaaggccttcacagagcttcaagccaaagttattgacactcaacagaaggtgaagctcgcagacatacagattgaacagctaaacagaacgaaaaagcatgcacatcttacagatacagagatcatgactttggtagatgagactaacatgtatgaaggtgtaggaagaatgtttattcttcagtccaaggaagcaattcacagtcagctgttagagaagcagaaaatagcagaagaaaaaattaaagaactagaacagaaaaagtcctacctggagcgaagcgttaaggaagctgaggacaacatccgggagatgctgatggcacgaagggcccagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - colipase, pancreatic
- carbonic anhydrase VI
- AHNAK nucleoprotein
- WD repeat domain 85

Buy PFDN1-prefoldin subunit 1 Gene now

Add to cart