Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DUSP18-dual specificity phosphatase 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP18-dual specificity phosphatase 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028724 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP18 |
| Origin species: | Human |
| Product name: | DUSP18-dual specificity phosphatase 18 Gene |
| Size: | 2ug |
| Accessions: | BC028724 |
| Gene id: | 150290 |
| Gene description: | dual specificity phosphatase 18 |
| Synonyms: | DSP18; DUSP20; LMWDSP20; dual specificity protein phosphatase 18; low molecular weight dual specificity phosphatase 20; dual specificity phosphatase 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacagcaccctcgtgtgccttcccagttcagttccggcagccctcagtcagcggcctctcgcagataaccaaaagcctgtatatcagcaatggtgtggccgccaacaacaagctcatgctgtctagcaaccagatcaccatggtcatcaatgtctcagtggagcgtggagatgaagcagggccgtactttgctgcactgtgctgctggtgtgagccgctcagctgccctgtgcctcgcctacctcatgaagtaccacgccatgtccctgctggacgcccacacgtggaccaagtcatgccggcccatcatccgacccaacagcggcttttgggagcagctcatccactatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC39821 - AKT1 substrate 1 (proline-rich) - hypothetical protein MGC40069 - RAD54 homolog B (S. cerevisiae) |