DUSP18-dual specificity phosphatase 18 Gene View larger

DUSP18-dual specificity phosphatase 18 Gene

PTXBC028724

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP18-dual specificity phosphatase 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP18-dual specificity phosphatase 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028724
Product type: DNA & cDNA
Ncbi symbol: DUSP18
Origin species: Human
Product name: DUSP18-dual specificity phosphatase 18 Gene
Size: 2ug
Accessions: BC028724
Gene id: 150290
Gene description: dual specificity phosphatase 18
Synonyms: DSP18; DUSP20; LMWDSP20; dual specificity protein phosphatase 18; low molecular weight dual specificity phosphatase 20; dual specificity phosphatase 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagcaccctcgtgtgccttcccagttcagttccggcagccctcagtcagcggcctctcgcagataaccaaaagcctgtatatcagcaatggtgtggccgccaacaacaagctcatgctgtctagcaaccagatcaccatggtcatcaatgtctcagtggagcgtggagatgaagcagggccgtactttgctgcactgtgctgctggtgtgagccgctcagctgccctgtgcctcgcctacctcatgaagtaccacgccatgtccctgctggacgcccacacgtggaccaagtcatgccggcccatcatccgacccaacagcggcttttgggagcagctcatccactatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC39821
- AKT1 substrate 1 (proline-rich)
- hypothetical protein MGC40069
- RAD54 homolog B (S. cerevisiae)

Buy DUSP18-dual specificity phosphatase 18 Gene now

Add to cart