KIAA1147-KIAA1147 Gene View larger

KIAA1147-KIAA1147 Gene

PTXBC012493

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1147-KIAA1147 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1147-KIAA1147 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012493
Product type: DNA & cDNA
Ncbi symbol: KIAA1147
Origin species: Human
Product name: KIAA1147-KIAA1147 Gene
Size: 2ug
Accessions: BC012493
Gene id: 57189
Gene description: KIAA1147
Synonyms: LCHN; PRO2561; protein LCHN
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcttgaattgattttgttctgtggtacaaataacatctatgaatatcatatctgtatatatctgaaccaagttgtgtgcagagaggttgatataactatatttacagaaaatgatttttacaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - parathymosin
- casein kappa
- G antigen 1
- calbindin 2

Buy KIAA1147-KIAA1147 Gene now

Add to cart