CAPZB-capping protein (actin filament) muscle Z-line, beta Gene View larger

CAPZB-capping protein (actin filament) muscle Z-line, beta Gene

PTXBC008095

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAPZB-capping protein (actin filament) muscle Z-line, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CAPZB-capping protein (actin filament) muscle Z-line, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008095
Product type: DNA & cDNA
Ncbi symbol: CAPZB
Origin species: Human
Product name: CAPZB-capping protein (actin filament) muscle Z-line, beta Gene
Size: 2ug
Accessions: BC008095
Gene id: 832
Gene description: capping protein (actin filament) muscle Z-line, beta
Synonyms: CAPB; CAPPB; CAPZ; F-actin-capping protein subunit beta; capZ beta; capping protein (actin filament) muscle Z-line, beta; capping actin protein of muscle Z-line beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctaaacctctgtttcatgctaaccagacacgccgtgcactcgttagattcctttcttagaaaactcgttttctgctcccttccctcgtcccttccctccccgacaggtcacataacagctgcatcattgaccgcacagcgccatctctccctgagaataaagccgatagccaccctcctccggctccgagcctgcttctgccacacctcgctctcagttctctccacatttccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology-like domain, family A, member 2
- membrane-spanning 4-domains, subfamily A, member 15
- dynein, cytoplasmic 2, light intermediate chain 1
- low density lipoprotein receptor adaptor protein 1

Buy CAPZB-capping protein (actin filament) muscle Z-line, beta Gene now

Add to cart