Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CAPZB-capping protein (actin filament) muscle Z-line, beta Gene
PTXBC008095
New product
Data sheet of CAPZB-capping protein (actin filament) muscle Z-line, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CAPZB-capping protein (actin filament) muscle Z-line, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008095 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CAPZB |
| Origin species: | Human |
| Product name: | CAPZB-capping protein (actin filament) muscle Z-line, beta Gene |
| Size: | 2ug |
| Accessions: | BC008095 |
| Gene id: | 832 |
| Gene description: | capping protein (actin filament) muscle Z-line, beta |
| Synonyms: | CAPB; CAPPB; CAPZ; F-actin-capping protein subunit beta; capZ beta; capping protein (actin filament) muscle Z-line, beta; capping actin protein of muscle Z-line beta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctaaacctctgtttcatgctaaccagacacgccgtgcactcgttagattcctttcttagaaaactcgttttctgctcccttccctcgtcccttccctccccgacaggtcacataacagctgcatcattgaccgcacagcgccatctctccctgagaataaagccgatagccaccctcctccggctccgagcctgcttctgccacacctcgctctcagttctctccacatttccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology-like domain, family A, member 2 - membrane-spanning 4-domains, subfamily A, member 15 - dynein, cytoplasmic 2, light intermediate chain 1 - low density lipoprotein receptor adaptor protein 1 |