Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SCRG1-scrapie responsive protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCRG1-scrapie responsive protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017583 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCRG1 |
| Origin species: | Human |
| Product name: | SCRG1-scrapie responsive protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC017583 |
| Gene id: | 11341 |
| Gene description: | scrapie responsive protein 1 |
| Synonyms: | SCRG-1; scrapie-responsive protein 1; scrapie responsive gene 1; scrapie-responsive gene 1 protein; stimulator of chondrogenesis 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaactgatggtacttgttttcaccattgggctaactttgctgctaggagttcaagccatgcctgcaaatcgcctctcttgctacagaaagatactaaaagatcacaactgtcacaaccttccggaaggagtagctgacctgacacagattgatgtcaatgtccaggatcatttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - defender against cell death 1 - Rab acceptor 1 (prenylated) - receptor accessory protein 4 - receptor accessory protein 2 |