SCRG1-scrapie responsive protein 1 Gene View larger

SCRG1-scrapie responsive protein 1 Gene

PTXBC017583

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCRG1-scrapie responsive protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCRG1-scrapie responsive protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017583
Product type: DNA & cDNA
Ncbi symbol: SCRG1
Origin species: Human
Product name: SCRG1-scrapie responsive protein 1 Gene
Size: 2ug
Accessions: BC017583
Gene id: 11341
Gene description: scrapie responsive protein 1
Synonyms: SCRG-1; scrapie-responsive protein 1; scrapie responsive gene 1; scrapie-responsive gene 1 protein; stimulator of chondrogenesis 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaactgatggtacttgttttcaccattgggctaactttgctgctaggagttcaagccatgcctgcaaatcgcctctcttgctacagaaagatactaaaagatcacaactgtcacaaccttccggaaggagtagctgacctgacacagattgatgtcaatgtccaggatcatttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - defender against cell death 1
- Rab acceptor 1 (prenylated)
- receptor accessory protein 4
- receptor accessory protein 2

Buy SCRG1-scrapie responsive protein 1 Gene now

Add to cart