RPS27-ribosomal protein S27 Gene View larger

RPS27-ribosomal protein S27 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS27-ribosomal protein S27 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS27-ribosomal protein S27 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002658
Product type: DNA & cDNA
Ncbi symbol: RPS27
Origin species: Human
Product name: RPS27-ribosomal protein S27 Gene
Size: 2ug
Accessions: BC002658
Gene id: 6232
Gene description: ribosomal protein S27
Synonyms: MPS-1; MPS1; S27; 40S ribosomal protein S27; metallopan-stimulin 1; metallopanstimulin 1; ribosomal protein S27
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctcgcaaaggatctccttcatccctctccagaagaggagaagaggaaacacaagaagaaacgcctggtgcagagccccaattcctacttcatggatgtgaaatgcccaggatgctataaaatcaccacggtctttagccatgcacaaacggtagttttgtgtgttggctgctccactgtcctctgccagcctacaggaggaaaagcaaggcttacagaaggatgttccttcaggaggaagcagcactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L35
- c-myc binding protein
- ribosomal protein L27
- carbonic anhydrase VIII

Buy RPS27-ribosomal protein S27 Gene now

Add to cart