Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LIMS2-LIM and senescent cell antigen-like domains 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LIMS2-LIM and senescent cell antigen-like domains 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001370 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LIMS2 |
| Origin species: | Human |
| Product name: | LIMS2-LIM and senescent cell antigen-like domains 2 Gene |
| Size: | 2ug |
| Accessions: | BC001370 |
| Gene id: | 55679 |
| Gene description: | LIM and senescent cell antigen-like domains 2 |
| Synonyms: | LGMD2W; PINCH-2; PINCH2; LIM and senescent cell antigen-like-containing domain protein 2; ILK-binding protein; LIM and senescent cell antigen-like domains 2; LIM-type zinc finger domains 2; particularly interesting new Cys-His protein 2; LIM zinc finger domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcccgtgtgtaagaggtgctacgagaagttcccgctggagctgaagaagcggctgaagaagctgtcggagctgacctcccgcaaggcccagcccaaggccacagacctcaactctgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - microphthalmia-associated transcription factor - tubulin tyrosine ligase-like family, member 3 - gem (nuclear organelle) associated protein 6 - fin bud initiation factor homolog (zebrafish) |