LIMS2-LIM and senescent cell antigen-like domains 2 Gene View larger

LIMS2-LIM and senescent cell antigen-like domains 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LIMS2-LIM and senescent cell antigen-like domains 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LIMS2-LIM and senescent cell antigen-like domains 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001370
Product type: DNA & cDNA
Ncbi symbol: LIMS2
Origin species: Human
Product name: LIMS2-LIM and senescent cell antigen-like domains 2 Gene
Size: 2ug
Accessions: BC001370
Gene id: 55679
Gene description: LIM and senescent cell antigen-like domains 2
Synonyms: LGMD2W; PINCH-2; PINCH2; LIM and senescent cell antigen-like-containing domain protein 2; ILK-binding protein; LIM and senescent cell antigen-like domains 2; LIM-type zinc finger domains 2; particularly interesting new Cys-His protein 2; LIM zinc finger domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcccgtgtgtaagaggtgctacgagaagttcccgctggagctgaagaagcggctgaagaagctgtcggagctgacctcccgcaaggcccagcccaaggccacagacctcaactctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - microphthalmia-associated transcription factor
- tubulin tyrosine ligase-like family, member 3
- gem (nuclear organelle) associated protein 6
- fin bud initiation factor homolog (zebrafish)

Buy LIMS2-LIM and senescent cell antigen-like domains 2 Gene now

Add to cart