Login to display prices
Login to display prices
MED9-mediator complex subunit 9 Gene View larger

MED9-mediator complex subunit 9 Gene

PTXBC010906

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MED9-mediator complex subunit 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MED9-mediator complex subunit 9 Gene

Proteogenix catalog: PTXBC010906
Ncbi symbol: MED9
Product name: MED9-mediator complex subunit 9 Gene
Size: 2ug
Accessions: BC010906
Gene id: 55090
Gene description: mediator complex subunit 9
Synonyms: MED25; mediator of RNA polymerase II transcription subunit 9; mediator of RNA polymerase II transcription, subunit 9 homolog; mediator subunit 25; mediator complex subunit 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctgctggggtggcagccgggcgacaggcggaggatgtattgccgccaacgtccgaccagccgctgcctgacaccaagccgctgccgcctcctcagccgccgccggtccctgcgcctcaaccgcagcagtcgccggcgccacggcctcagtcacctgcccgcgcgagggaggaagagaactactcctttttacctttggttcacaacatcatcaaatggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: