MED9-mediator complex subunit 9 Gene View larger

MED9-mediator complex subunit 9 Gene

PTXBC010906

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MED9-mediator complex subunit 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MED9-mediator complex subunit 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010906
Product type: DNA & cDNA
Ncbi symbol: MED9
Origin species: Human
Product name: MED9-mediator complex subunit 9 Gene
Size: 2ug
Accessions: BC010906
Gene id: 55090
Gene description: mediator complex subunit 9
Synonyms: MED25; mediator of RNA polymerase II transcription subunit 9; mediator of RNA polymerase II transcription, subunit 9 homolog; mediator subunit 25; mediator complex subunit 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctgctggggtggcagccgggcgacaggcggaggatgtattgccgccaacgtccgaccagccgctgcctgacaccaagccgctgccgcctcctcagccgccgccggtccctgcgcctcaaccgcagcagtcgccggcgccacggcctcagtcacctgcccgcgcgagggaggaagagaactactcctttttacctttggttcacaacatcatcaaatggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SFT2 domain containing 3
- ferritin, light polypeptide
- peptidyl-tRNA hydrolase 2
- cystatin F (leukocystatin)

Buy MED9-mediator complex subunit 9 Gene now

Add to cart