Login to display prices
Login to display prices
HTN3-histatin 3 Gene View larger

HTN3-histatin 3 Gene

PTXBC009791

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HTN3-histatin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HTN3-histatin 3 Gene

Proteogenix catalog: PTXBC009791
Ncbi symbol: HTN3
Product name: HTN3-histatin 3 Gene
Size: 2ug
Accessions: BC009791
Gene id: 3347
Gene description: histatin 3
Synonyms: HIS2; HTN2; HTN5; histatin-3; basic histidine-rich protein; histatin-4; histatin-5; histatin-6; histatin-7; histatin-8; histatin-9; histidine-rich protein 3; hst; histatin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagttttttgtttttgctttaatcttggctctcatgctttccatgactggagctgattcacatgcaaagagacatcatgggtataaaagaaaattccatgaaaagcatcattcacatcgaggctatagatcaaattatctgtatgacaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: