Login to display prices
Login to display prices
C1orf101-chromosome 1 open reading frame 101 Gene View larger

C1orf101-chromosome 1 open reading frame 101 Gene

PTXBC032859

New product

Data sheet of C1orf101-chromosome 1 open reading frame 101 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf101-chromosome 1 open reading frame 101 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC032859
Product type: DNA & cDNA
Ncbi symbol: C1orf101
Origin species: Human
Product name: C1orf101-chromosome 1 open reading frame 101 Gene
Size: 2ug
Accessions: BC032859
Gene id: 257044
Gene description: chromosome 1 open reading frame 101
Synonyms: uncharacterized protein C1orf101; chromosome 1 open reading frame 101
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagcccgggaagtggccgtgctgctgctgtggctgagctgctatggctccgccctttggaggtattccactaacagcccaaactatcgcatttttagtaccagaagtactattaagttagagtatgaaggaacattatttactgagtggagtgtgccagaaacttgttttgtgctaaataaaagctcacccacgacagaattgcgttgttcctcacctggtgttcacgctataaaaccaattgttactggcccagatgaagaagaacgctatttatttgtggaaagttctcatacttgctttctgtggtactatagagttagacatttctttaacaactttacccagcttatcactgtgtgggcatatgatccagaaagtgcagatcctgatgagttgctggggaatgcagaagaaccttcaataaattccatagtactcagcacacagatggccacattgggacagaagcctgtcatacatacagttctgaagagaaaagtttattcttcaaatgagaaaatgagaaggggtacctggcgtattgtagtaccaatgacaaaagatgatgcactaaaggagattagaggaaaccaagttacttttcaggattgctttattgcagattttcttattctgttgacttttcctttgttgaccatacctgaaattcctggttatttaccaatctcctcaccacgtggtagtcaattaatggcttcctgggatgcttgtgtagttgcatctgctgttttggtgacagatatggagacctttcacacaactgattcattcaaatcttggaccagaatcagagtgcctccagacattctgagtgatgatgaaagacggagtgtggctcatgtgatcttatcgcgggatggaatcgtttttcttataaatggtgttctttacataaagagttttcgtggatttataagactgggaggaattgtaaatcttcctgatggtggaattactggcatttcatcaagaaaatggtgttgggtcaattatttattaaaggctaaaggaagaagaagcacctttgcagtctggacagaaaatgaaatttacctcggatccattcttcttaagtttgccagattagtaactaccacagaactgaaaaacatcctaagtctatcggtgactgctactctgaccatagacagggttgagtatacaggacaccctctggagattgctgtgtttttaaattattgcactgtatgtaacgtcaccaaaaagattttcttagtgatatataatgaagatacaaaacagtgggtttcccaagactttacattagatgcccctattgacagtgttaccatgccacattttacattttcagcactgccaggattactgctatggaacaagcatagtatctactattgttaccataatttcacctttactgggattttacagacacctgcaggacatggaaatctatcaatgctatcaaatgacagcattattcatgaagttttcatagattattatggagatattttggtaaaaatggaaaataatgtaatattttattccaagattaatactagagatgcagtaaagctgcatttatggacaaattacacaacaagagcattcattttcttaagtacatctggtcaaacatatttcctgtatgctttggatgatggcacaatacaaatacaggactatcccttacatctggaagcacaaagtatagctttcacaacaaaagacaaatgcccatacatggcatttcataacaatgttgctcatgttttttactttttggacaagggagaggctctgacagtttggactcagatcgtctatccagaaaacactggtctgtatgttattgtggaatcttatggcccaaaaatattacaagagagtcatgagatttcctttgaagctgcctttggatactgcaccaaaactctgacactaacattttatcagaatgtagattatgagagaatatctgattactttgagacacaagacaagcacacgggtcttgtgctggttcagtttcgacctagtgaatattcaaaagcatgtccaatagcccaaaaggtgttccaaatagctgttggctgtgatgataaaaaattcattgcaattaaaggatttagtaaaaaaggatgtcatcaccatgatttttcatacgtgattgaaaagtcatatctgaggcatcagccatcgaaaaacttgagagtaaggtatatttggggagaatatggctgccctctgaggcttgacttcacagaaaagtttcaacctgtggttcaactatttgatgataatggctatgttaaagacgttgaagcaaatttcatagtgtgggaaatacacggcagggatgactatagctttaataatactatggcacagagtggttgtttacatgaagcacagacatggaagtcaatgattgaacttaacaagcacctcccactagaagaagtctggggacctgagtttctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - component of oligomeric golgi complex 2
- interferon, gamma-inducible protein 16
- chromosome 10 open reading frame 12
- nuclear receptor interacting protein 1