Login to display prices
Login to display prices
WDR24-WD repeat domain 24 Gene View larger

WDR24-WD repeat domain 24 Gene

PTXBC008025

New product

Data sheet of WDR24-WD repeat domain 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR24-WD repeat domain 24 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC008025
Product type: DNA & cDNA
Ncbi symbol: WDR24
Origin species: Human
Product name: WDR24-WD repeat domain 24 Gene
Size: 2ug
Accessions: BC008025
Gene id: 84219
Gene description: WD repeat domain 24
Synonyms: C16orf21; JFP7; WD repeat-containing protein 24; WD repeat domain 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagatgtcccgtgtgaccacagccctgggtggcagcgtgctgacaggccgcaccatgcactgccacctggatgctcccgccaatgccatcagtgtgtgccgcgacgcagcccaggtggtcgtggcaggccgtagcatcttcaagatctatgccatcgaggaggaacagttcgtggaaaagctgaacctgcgtgtggggcgcaagccttcgcttaacctgagctgtgctgacgtggtctggcaccagatggatgagaacctgctggccacagcagccaccaatggcgtggtggtcacgtggaacctgggccggccatcccgcaacaagcaggaccagctgttcacagaacacaagcgcacggtaaacaaagtctgcttccaccccaccgaagcccacgtgctgctcagtggctcccaggatggcttcatgaagtgctttgacctccgcagaaaggactctgtcagcaccttctcgggccagtcggagagcgtgcgggacgtgcagttcagtatccgggactacttcaccttcgcctccacctttgagaacggcaatgtgcagctctgggacatccggcgtcccgaccggtgcgagaggatgttcacagcccacaacggacccgtcttctgctgcgactggcaccccgaggacaggggctggttggccactggagggcgcgacaagatggtgaaggtctgggacatgaccacgcaccgtgccaaggagatgcactgtgtgcagaccatcgcctcggtggcccgtgtgaagtggcggccagagtgccgccaccacctggccacatgctccatgatggtggaccacaacatctatgtttgggacgtgcgccggcccttcgtgccagctgccatgtttgaggaacaccgagacgtcaccacgggaattgcctggcgccacccccacgacccctccttcctgctgtctggctccaaggacagctcgctgtgccagcacctgttccgcgacgccagccagcccgtcgagcgcgccaaccctgagggcctctgctacggcctcttcggggacctggccttcgccgccaaggagagcctcgtggctgccgagtcggggcgcaagccctacactggcgaccggcgccaccccatcttctttaagcgcaagctggaccctgccgagcccttcgcaggcctcgcctccagtgccctcagtgtctttgagacggagccaggtggcggcggcatgcgctggtttgtggacacagctgagcgttatgcgctggctggccggccactggccgagctctgtgaccacaacgcaaaggtggctcgagagcttggccgcaaccaggtggcgcaaacgtggaccatgctgcggatcatctactgcagccctggcctagtgcccactgcaaacctcaaccacagtgtgggcaagggtggctcctgtggcctcccgctcatgaacagtttcaacctgaaggatatggccccagggttgggcagtgagacgcggctggaccgcagcaaaggagatgcacggagcgacacagttctgctcgactcctcggccacactcatcaccaatgaggataacgaggaaaccgagggcagcgacgtacctgccgactacctgctgggtgacgtggaaggtgaggaggacgagctgtacctgctggatccggaacacgcgcaccccgaggaccctgagtgcgtgctgccgcaggaggcctttccgctgcgccacgagatcgtggacacgcctcccgggcccgagcacctgcaggacaaggccgactccccgcacgtgagcggcagcgaggcggatgtggcctccctggcccccgtggactcctccttctcgctcctgtctgtctcacacgcgctctacgacagccgcctgccgcccgacttcttcggcgtgctggtgcgcgacatgctgcacttctacgctgagcagggcgacgtgcagatggctgtgtctgtgctcatcgtcctgggtgaacgggtgcgcaaggacatcgacgagcagacccaggagcactggtacacttcctacatcgacctgctgcagcgcttccgcctctggaacgtgtccaacgaggtggtcaagctgagcaccagccgcgccgtcagctgcctcaaccaggcctccaccaccctgcacgtcaactgcagccactgcaagcggcccatgagcagccggggctgggtctgcgacaggtgccaccgctgcgccagcatgtgtgccgtctgccaccacgtagtcaagggtctcttcgtgtggtgccagggctgcagccacggcggccacctgcagcacatcatgaagtggctggaaggcagctcccactgtcccgcaggctgcggccacctctgcgagtactcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 66
- toll-like receptor 7
- WD repeat domain 60
- WD repeat domain 47