Login to display prices
Login to display prices
ENTPD4-ectonucleoside triphosphate diphosphohydrolase 4 Gene View larger

ENTPD4-ectonucleoside triphosphate diphosphohydrolase 4 Gene

PTXBC034477

New product

Data sheet of ENTPD4-ectonucleoside triphosphate diphosphohydrolase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ENTPD4-ectonucleoside triphosphate diphosphohydrolase 4 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC034477
Product type: DNA & cDNA
Ncbi symbol: ENTPD4
Origin species: Human
Product name: ENTPD4-ectonucleoside triphosphate diphosphohydrolase 4 Gene
Size: 2ug
Accessions: BC034477
Gene id: 9583
Gene description: ectonucleoside triphosphate diphosphohydrolase 4
Synonyms: LAP70; LYSAL1; NTPDase-4; UDPase; ectonucleoside triphosphate diphosphohydrolase 4; golgi luminal UDPase; guanosine-diphosphatase like protein; lysosomal apyrase-like 1; lysosomal apyrase-like protein of 70 kDa; uridine-diphosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaggattggcatctcctgtctttttcctgcttcttggcattttagcatatctccagtagggtgtcctcgaattctgaataccaatttacgccaaattatggtcattagtgtcctggctgctgctgtttcacttttatatttttctgttgtcataatccgaaataagtatgggcgactaaccagagacaagaaatttcaaaggtacctggcacgagttaccgacattgaagctacagacaccaataaccccaatgtgaactatgggatcgtggtggactgtggtagcagtgggtctcgagtatttgtttactgctggccaaggcataatggcaatccacatgatctgttggatatcaggcaaatgagggataaaaaccgaaagccagtggtcatgaagataaaaccgggcatttcagaatttgctacctctccagagaaagtcagtgattacatttctccacttttgaactttgctgcagagcatgtgccacgggcaaaacacaaagagacacctctctacattctctgcacggctggaatgagaatcctccccgaaagccagcagaaagctattctggaagaccttctgaccgatatccccgtgcactttgactttctgttttctgactctcatgcagaagtaatttctgggaaacaagaaggtgtgtatgcttggattggcattaattttgtccttggacgatttgagcatattgaagatgatgatgaggccgttgtggaagttaacattcctggaagtgaaagcagcgaagccattgtccgtaaaaggacagcgggcattctcgacatgggcggcgtgtcgactcagatagcgtacgaagtccccaaaactgaagaagtagctaaaaacttgttagctgaatttaacttgggatgtgatgttcaccaaactgagcatgtgtatcgagtctatgtggccacgtttcttgggtttggtggcaatgctgctcgacagagatacgaagacagaatatttgccaacaccattcaaaagaacaggctcctgggtaaacagactggtctgactcctgatatgccgtacttggacccctgcctacccctagacattaaagatgaaatccagcaaaatggacaaaccatatacctacgagggactggagactttgacctgtgtcgagagactatccagcctttcatgaataaaacaaacgagacccagacttccctcaatggggtctaccagcccccaattcacttccagaacagtgaattctatggcttctccgaattctactactgcaccgaggatgtgttacgaatggggggagactacaatgctgctaaatttactaaagctgcaaaggattattgtgcaacaaagtggtccattttgcgggaacgctttgaccgaggactgtacgcctctcatgctgacctccacaggcttaagtatcagtgcttcaaatcggcctggatgtttgaggtgtttcataggggcttttcgtttcctgtcaactataaaagcttaaagactgccttgcaagtttacgacaaggaggttcagtggacccttggagccatcctctacaggacccgctttctaccattaaggaaaatagggatgctgataataccttgctcagggggttgtccaaagctgtgttgtgcagtatggcagccaccaccatatggggccaccaaacacttgcaatgtgctgcttggaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - connector enhancer of kinase suppressor of Ras 1
- mitogen-activated protein kinase kinase kinase 6
- adaptor-related protein complex 3, beta 1 subunit
- ATPase, Na+/K+ transporting, alpha 3 polypeptide