Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAB8A-RAB8A, member RAS oncogene family Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAB8A-RAB8A, member RAS oncogene family Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002977 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAB8A |
| Origin species: | Human |
| Product name: | RAB8A-RAB8A, member RAS oncogene family Gene |
| Size: | 2ug |
| Accessions: | BC002977 |
| Gene id: | 4218 |
| Gene description: | RAB8A, member RAS oncogene family |
| Synonyms: | RAB8A, member RAS oncogene family; MEL; ras-related protein Rab-8A; mel transforming oncogene (RAB8 homolog); mel transforming oncogene (derived from cell line NK14); mel transforming oncogene (derived from cell line NK14)- RAB8 homolog; oncogene c-mel; ras-associated protein RAB8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaagacctacgattacctgttcaagctgctgctgatcggggactcgggggtggggaagacctgtgtcctgttccgcttctccgaggacgccttcaactccacttttatctccaccataggaattgactttaaaattaggaccatagagctcgatggcaagagaattaaactgcagatatgggacacagccggtcaggaacggtttcggacgatcacaacggcctactacaggggtgcaatgggcatcatgctggtctacgacatcaccaacgagaagtccttcgacaacatccggaactggattcgcaacattgaggagcacgcctctgcagacgtcgaaaagatgatactcgggaacaagtgtgatgtgaatgacaagagacaagtttccaaggaacggggagaaaagctggccctcgactatggaatcaagttcatggagaccagcgcgaaggccaacatcaatgtggaaaatgcatttttcactctcgccagagatatcaaagcaaaaatggacaaaaaattggaaggcaacagcccccaggggagcaaccagggagtcaaaatcacaccggaccagcagaagaggagcagctttttccgatgtgttcttctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of G-protein signaling 1 - eyes absent homolog 2 (Drosophila) - leucine-rich, glioma inactivated 1 - coiled-coil domain containing 22 |