Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C16orf80-chromosome 16 open reading frame 80 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C16orf80-chromosome 16 open reading frame 80 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005152 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C16orf80 |
| Origin species: | Human |
| Product name: | C16orf80-chromosome 16 open reading frame 80 Gene |
| Size: | 2ug |
| Accessions: | BC005152 |
| Gene id: | 29105 |
| Gene description: | chromosome 16 open reading frame 80 |
| Synonyms: | UPF0468 protein C16orf80; C16orf80; EVORF; GTL3; fSAP23; cilia- and flagella-associated protein 20; basal body up-regulated protein 22; flagellar associated protein 20 homolog; functional spliceosome-associated protein 23; gene trap locus 3; transcription factor IIB; cilia and flagella associated protein 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcaaaaacacgttccagagcggcttcctctccatcctctacagcatcggcagcaagcctctgcaaatctgggacaaaaaggtacggaatggccacatcaaaagaatcactgataatgacatccagtccctggtgctagagattgaagggacaaatgtaagcaccacatatatcacatgccctgcagaccccaagaagacgctgggaattaaacttcctttccttgtcatgattatcaaaaacctgaagaagtattttaccttcgaagtgcaggtactagatgacaagaatgtgcgtcgtcgctttcgggcaagtaactaccagagcaccacccgggtcaaacccttcatctgcaccatgcccatgcggctggatgacggctggaaccagattcagttcaacttgctagacttcacacggcgagcatacggcaccaattacatcgagaccctcagagtgcagatccatgcaaattgtcgcatccgacgggtttacttctcagacagactctactcagaagatgagctgccggcagagttcaaactgtatctcccagttcagaacaaggcaaagcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 11 open reading frame 58 - chromosome 11 open reading frame 54 - karyopherin alpha 4 (importin alpha 3) - karyopherin alpha 1 (importin alpha 5) |