Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PGRMC1-progesterone receptor membrane component 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PGRMC1-progesterone receptor membrane component 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034238 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PGRMC1 |
| Origin species: | Human |
| Product name: | PGRMC1-progesterone receptor membrane component 1 Gene |
| Size: | 2ug |
| Accessions: | BC034238 |
| Gene id: | 10857 |
| Gene description: | progesterone receptor membrane component 1 |
| Synonyms: | HPR6.6; MPR; membrane-associated progesterone receptor component 1; progesterone binding protein; progesterone receptor membrane component 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccgaggatgtggtggcgactggcgccgacccaagcgatctggagagcggcgggctgctgcatgagattttcacgtcgccgctcaacctgctgctgcttggcctctgcatcttcctgctctacaagatcgtgcgcggggaccagccggcggccagcggcgacagcgacgacgacgagccgccccctctgccccgcctcaagcggcgcgacttcacccccgccgagctgcggcgcttcgacggcgtccaggacccgcgcatactcatggccatcaacggcaaggtgttcgatgtgaccaaaggccgcaaattctacgggcccgaggggccgtatggggtctttgctggaagagatgcatccaggggccttgccacattttgcctggataaggaagcactgaaggatgagtacgatgacctttctgacctcactgctgcccagcaggagactctgagtgactgggagtctcagttcactttcaagtatcatcacgtgggcaaactgctgaaggagggggaggagcccactgtgtactcagatgaggaagaaccaaaagatgagagtgcccggaaaaatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lymphotoxin alpha (TNF superfamily, member 1) - zinc finger and SCAN domain containing 5A - germ cell-less homolog 1 (Drosophila)-like - phenylalanyl-tRNA synthetase, alpha subunit |