Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C16orf5-chromosome 16 open reading frame 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C16orf5-chromosome 16 open reading frame 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002882 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C16orf5 |
| Origin species: | Human |
| Product name: | C16orf5-chromosome 16 open reading frame 5 Gene |
| Size: | 2ug |
| Accessions: | BC002882 |
| Gene id: | 29965 |
| Gene description: | chromosome 16 open reading frame 5 |
| Synonyms: | C16orf5; CDIP; LITAFL; cell death-inducing p53-target protein 1; LITAF-like protein; cell death inducing protein; cell death involved p53-target; lipopolysaccharide-induced tumor necrosis factor-alpha-like protein; transmembrane protein I1; cell death inducing p53 target 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccagcgagcctccccctccttatcctgggggccccacagccccacttctggaagagaaaagtggagccccgcccaccccaggccgttcctccccagctgtgatgcagccccctccaggcatgccactgccccctgcggacattggccccccaccctatgagccgccgggtcacccaatgccccagcctggcttcatcccaccacacatgagtgcagatggcacctacatgcctccgggtttctaccctcctccaggcccccacccacccatgggctactaccccccagggccctacacgccagggccctaccctggccctgggggccacacagccacagtcctggtcccttcaggagctgccaccacggtgacagtgctgcagggagagatctttgagggagcgcctgtgcagacggtgtgtccccactgccagcaggccatcaccaccaagatctcctacgagattggcttgatgaatttcgtgctgggtttcttctgttgcttcatgggatgtgatctgggctgctgcctgatcccctgcctcatcaatgacttcaaggatgtgacgcacacatgccccagctgcaaagcctacatctacacgtacaagcgcctgtgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S11 - chromosome 9 open reading frame 86 - deoxynucleotidyltransferase, terminal - chromosome 3 open reading frame 44 |