Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MED18-mediator complex subunit 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MED18-mediator complex subunit 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MED18 |
| Origin species: | Human |
| Product name: | MED18-mediator complex subunit 18 Gene |
| Size: | 2ug |
| Accessions: | BC002694 |
| Gene id: | 54797 |
| Gene description: | mediator complex subunit 18 |
| Synonyms: | p28b; mediator of RNA polymerase II transcription subunit 18; TRAP/mediator complex subunit p28b; mediator of RNA polymerase II transcription, subunit 18 homolog; mediator complex subunit 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcacctccagtcaccatgatgcctgtcactgggggcaccattaacatgatggagtacctgttgcagggaagtgttttagatcacagtttggaaagcctcatccaccgccttcgtggtttgtgtgacaacatggaacctgagactttccttgaccatgagatggtattcctccttaagggccagcaagccagcccatttgttctcagggcccgacgctctatggacagggcaggggcaccctggcatctgcgctacctgggacagccagaaatgggagacaagaaccgccatgccctggtgcgaaactgcgtggacattgccacatctgagaacctcaccgacttcttgatggaaatgggcttccgcatggaccatgagtttgttgctaagggacatttgttccgtaagggcatcatgaagattatggtgtacaagattttccgcatcctggtgccagggaacacagacagcactgaggccttgtcactctcctatctcgtggaattaagtgtggtagcacccgctgggcaggacatggtctctgatgacatgaagaacttcgcagaacagctaaaacctctggttcacctagagaaaatagaccccaagaggctcatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine dioxygenase, type I - transmembrane protein 165 - centrin, EF-hand protein, 2 - 3-oxoacid CoA transferase 1 |