Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIGH-phosphatidylinositol glycan anchor biosynthesis, class H Gene
PTXBC004100
New product
Data sheet of PIGH-phosphatidylinositol glycan anchor biosynthesis, class H Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIGH-phosphatidylinositol glycan anchor biosynthesis, class H Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004100 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIGH |
| Origin species: | Human |
| Product name: | PIGH-phosphatidylinositol glycan anchor biosynthesis, class H Gene |
| Size: | 2ug |
| Accessions: | BC004100 |
| Gene id: | 5283 |
| Gene description: | phosphatidylinositol glycan anchor biosynthesis, class H |
| Synonyms: | GPI-H; phosphatidylinositol N-acetylglucosaminyltransferase subunit H; PIG-H; phosphatidylinositol-glycan biosynthesis, class H protein; phosphatidylinositol glycan anchor biosynthesis class H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggatgagcggagcttttcggatatctgcggcggccgcctggcgctgcagcgccgctactactccccgtcctgccgggaattctgcctcagctgccctcggctctcgctgcgttcgctcaccgctgtcacctgcacggtgtggctggcggcctacggactcttcaccctctgcgagaacagcatgatcctctctgctgccatcttcatcaccctcttaggtctgcttggttatctccattttgtgaagattgatcaggagactctgttaatcattgattcccttggcattcagatgacttcatcttatgcttcaggcaaagaaagcactaccttcatagaaatgggcaaggtcaaggatattgtcatcaatgaggccatttacatgcagaaggtgatttactacctctgcatcttattgaaagatccagtggaaccacatgggatatcccaagtagtacccgtcttccagagtgccaagccccggctggactgcttgattgaagtatacaggagctgccaggagatcctggcacaccagaaagccacatcaacaagcccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanylate binding protein 1, interferon-inducible, 67kDa - discs, large (Drosophila) homolog-associated protein 5 - discs, large (Drosophila) homolog-associated protein 5 - dehydrogenase E1 and transketolase domain containing 1 |