Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of B9D1-B9 protein domain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B9D1-B9 protein domain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002944 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B9D1 |
| Origin species: | Human |
| Product name: | B9D1-B9 protein domain 1 Gene |
| Size: | 2ug |
| Accessions: | BC002944 |
| Gene id: | 27077 |
| Gene description: | B9 protein domain 1 |
| Synonyms: | EPPB9; JBTS27; MKS9; MKSR1; B9 domain-containing protein 1; B9 protein domain 1; MKS1-related protein 1; endothelial precursor protein B9; B9 domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaccgcgagtcctagcgtctttctactcatggtcaacgggcaggtggagagcgcccagtttccagagtatgatgacctctactgcaagtactgctttgtgtacggccaggactgggcccccacagcgggtctggaggaggggatctcacagatcacatccaagagccaagatgtgcggcaagcactggtgtggaacttccccattgatgtcacctttaaaagcaccaacccctacggctggccacagatcgtgctcagcgtgtatggaccagatgtgttcgggaacgatgtggttcgaggctatggggccgtgcacgtgcccttctcacctggccggcacaaaaggaccatccccatgtttgtcccagaatctacgtctaaactgcagaagtttacaagtttgtgcctggtcgcctcctcagatctgcaagctgctccacccactgaggacaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - B9 protein domain 2 - nucleoporin like 2 - synaptotagmin XVII - monoamine oxidase A |