Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2F-polymerase (RNA) II (DNA directed) polypeptide F Gene
PTXBC003582
New product
Data sheet of POLR2F-polymerase (RNA) II (DNA directed) polypeptide F Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2F-polymerase (RNA) II (DNA directed) polypeptide F Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003582 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2F |
| Origin species: | Human |
| Product name: | POLR2F-polymerase (RNA) II (DNA directed) polypeptide F Gene |
| Size: | 2ug |
| Accessions: | BC003582 |
| Gene id: | 5435 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide F |
| Synonyms: | HRBP14.4; POLRF; RPABC14.4; RPABC2; RPB14.4; RPB6; RPC15; DNA-directed RNA polymerases I, II, and III subunit RPABC2; DNA-directed RNA polymerase II subunit F; DNA-directed RNA polymerases I, II, and III 14.4 kDa polypeptide; RNA Polymerase II subunit 14.4 kD; RNA polymerases I, II, and III subunit ABC2; polymerase (RNA) II (DNA directed) polypeptide F; polymerase (RNA) II subunit F; RNA polymerase II subunit F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagacaacgaggacaattttgatggcgacgactttgatgatgtggaggaggatgaagggctagatgacttggagaatgccgaagaggaaggccaggagaatgtcgagatcctcccctctggggagcgaccgcaggccaaccagaagcgaatcaccacaccatacatgaccaagtacgagcgagcccgcgtgctgggcacccgagcgctccagattgcgatgtgtgcccctgtgatggtggagctggagggggagacagatcctctgctcattgccatgaaggaactcaaggcccgaaagatccccatcatcattcgccgttacctgccagatgggagctatgaagactggggggtggacgagctcatcatcaccgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase inhibitor 1A (p21, Cip1) - terminal uridylyl transferase 1, U6 snRNA-specific - family with sequence similarity 114, member A2 - major facilitator superfamily domain containing 8 |