Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006182 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CALM3 |
| Origin species: | Human |
| Product name: | CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene |
| Size: | 2ug |
| Accessions: | BC006182 |
| Gene id: | 808 |
| Gene description: | calmodulin 3 (phosphorylase kinase, delta) |
| Synonyms: | CaM; CaMIII; HEL-S-72; PHKD; PHKD3; calmodulin; epididymis secretory protein Li 72; phosphorylase kinase subunit delta; prepro-calmodulin 3; calmodulin 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgaccagctgactgaggagcagattgcagagttcaaggaggccttctccctctttgacaaggatggagatggcactatcaccaccaaggagttggggacagtgatgagatccctgggacagaaccccactgaagcagagctgcaggatatgatcaatgaggtggatgcagatgggaacgggaccattgacttcccggagttcctgaccatgatggccagaaagatgaaggacacagacagtgaggaggagatccgagaggcgttccgtgtctttgacaaggatgggaatggctacatcagcgccgcagagctgcgtcacgtaatgacgaacctgggggagaagctgaccgatgagtctctctccatgcccctcatctcttccttttgccctcgcctcttccatccatgtcttccaaggcctgatgcattcataagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 4D interacting protein - nucleolar protein family 6 (RNA-associated) - chromodomain helicase DNA binding protein 2 - cytochrome c oxidase subunit IV isoform 1 |