Login to display prices
Login to display prices
ZNF343-zinc finger protein 343 Gene View larger

ZNF343-zinc finger protein 343 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF343-zinc finger protein 343 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF343-zinc finger protein 343 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002897
Product type: DNA & cDNA
Ncbi symbol: ZNF343
Origin species: Human
Product name: ZNF343-zinc finger protein 343 Gene
Size: 2ug
Accessions: BC002897
Gene id: 79175
Gene description: zinc finger protein 343
Synonyms: dJ734P14.5; zinc finger protein 343
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgttgccttatccttcagcactgggagatcaatactgggaagagattttgcttccaaagaatggggaaaatgtagagactatgaagaaattgacccaaaatcataaagcgaaaggcttgccttctaatgatactgactgcccccagaaaaaggagggaaaggcccaaatagtggtaccagttacattcagggatgtgactgtgatcttcacagaagcagaatggaagagactgagtccagagcagaggaatctatacaaagaagtgatgctggagaattacaggaatcttctctcattgggtcaggagatcgagaccatcctggccaacatagtgaaatcccatctctactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 181
- Bardet-Biedl syndrome 10
- THAP domain containing 4
- ADP-ribosylation factor 5