PTMA-prothymosin, alpha Gene View larger

PTMA-prothymosin, alpha Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTMA-prothymosin, alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTMA-prothymosin, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003510
Product type: DNA & cDNA
Ncbi symbol: PTMA
Origin species: Human
Product name: PTMA-prothymosin, alpha Gene
Size: 2ug
Accessions: BC003510
Gene id: 5757
Gene description: prothymosin, alpha
Synonyms: TMSA; gene sequence 28; prothymosin alpha protein; prothymosin, alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaaggtggggaggaagaggaggaggaagaagaaggtgatggtgaggaagaggatggagatgaagatgaggaagctgagtcagctacgggcaagcgggcagctgaagatgatgaggatgacgatgtcgataccaagaagcagaagaccgacgaggatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ataxin 7-like 1
- sperm flagellar 1
- neurocalcin delta
- calcyphosine-like

Buy PTMA-prothymosin, alpha Gene now

Add to cart