Login to display prices
Login to display prices
UBQLN4-ubiquilin 4 Gene View larger

UBQLN4-ubiquilin 4 Gene

PTXBC006410

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBQLN4-ubiquilin 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBQLN4-ubiquilin 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006410
Product type: DNA & cDNA
Ncbi symbol: UBQLN4
Origin species: Human
Product name: UBQLN4-ubiquilin 4 Gene
Size: 2ug
Accessions: BC006410
Gene id: 56893
Gene description: ubiquilin 4
Synonyms: A1U; A1Up; C1orf6; CIP75; UBIN; ubiquilin-4; ataxin-1 interacting ubiquitin-like protein; ataxin-1 ubiquitin-like interacting protein; ataxin-1 ubiquitin-like-interacting protein A1U; connexin43-interacting protein of 75 kDa; ubiquilin 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccagcttttggctggaagtggaaactcacaggtgcagacgccagaagtgagatttcagcagcagctggagcagctcaactccatgggcttcatcaatcgtgaggctaacctgcaggccctgattgccacaggaggggacatcaacgcagctatcgagagactgctgggctcccagctctcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin 2
- CD83 molecule
- ribophorin II
- plakophilin 3