Login to display prices
Login to display prices
TM2D2-TM2 domain containing 2 Gene View larger

TM2D2-TM2 domain containing 2 Gene

PTXBC004878

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM2D2-TM2 domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TM2D2-TM2 domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004878
Product type: DNA & cDNA
Ncbi symbol: TM2D2
Origin species: Human
Product name: TM2D2-TM2 domain containing 2 Gene
Size: 2ug
Accessions: BC004878
Gene id: 83877
Gene description: TM2 domain containing 2
Synonyms: BLP1; TM2 domain-containing protein 2; BBP-like protein 1; beta-amyloid-binding protein-like protein 1; TM2 domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgatcatgatcttactggtgaattacagacctgatgaatttatagaatgtgaagacccagtggatcatgttggaaatgcaactgcatcccaggaacttggttatggttgtctcaagttcggcggtcaggcctacagcgacgtggaacacacttcagtccagtgccatgccttagatggaattgagtgtgccagtcctaggacctttctacgagaaaataaaccttgtataaagtataccggacactacttcataaccactttactctactccttcttcctgggatgttttggtgtggatcgattctgtttgggacacactggcactgcagtagggaagctgttgacgcttggaggacttgggatttggtggtttgttgaccttattttgctaattactggagggctgatgccaagtgatggcagcaactggtgcactgtttactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aspartyl aminopeptidase
- sal-like 2 (Drosophila)
- BCL2-antagonist/killer 1
- interleukin 21 receptor