Login to display prices
Login to display prices
TXNL4B-thioredoxin-like 4B Gene View larger

TXNL4B-thioredoxin-like 4B Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNL4B-thioredoxin-like 4B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TXNL4B-thioredoxin-like 4B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009646
Product type: DNA & cDNA
Ncbi symbol: TXNL4B
Origin species: Human
Product name: TXNL4B-thioredoxin-like 4B Gene
Size: 2ug
Accessions: BC009646
Gene id: 54957
Gene description: thioredoxin-like 4B
Synonyms: DLP; Dim2; thioredoxin-like protein 4B; Dim1-like protein; thioredoxin like 4B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcttcctactgcccaagctgactagcaaaaaggaagtagaccaggcgataaaaagtactgctgagaaggtgttggttctcaggtttgggagagatgaagatcctgtctgtctgcagctagatgatattctttctaagacctcttctgacttaagtaaaatggctgctatatacctggtagatgtggaccaaactgcagtttatacacagtattttgacatcagttatattccatctactgtctttttcttcaatgggcagcatatgaaagtggattatggatctccagatcacactaagtttgtgggaagcttcaaaaccaaacaagacttcatagatttgattgaagtaatctatcgaggagcaatgagggggaagcttattgtccaaagtcctattgatcccaagaatattcccaaatatgaccttctctatcaagacatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - surfactant protein C
- exosome component 1
- asparagine synthetase
- transketolase-like 1