Login to display prices
Login to display prices
SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene View larger

SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene

PTXBC038932

New product

Data sheet of SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC038932
Product type: DNA & cDNA
Ncbi symbol: SMEK1
Origin species: Human
Product name: SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene
Size: 2ug
Accessions: BC038932
Gene id: 55671
Gene description: SMEK homolog 1, suppressor of mek1 (Dictyostelium)
Synonyms: SMEK1; FLFL1; KIAA2010; MSTP033; PP4R3; PP4R3A; smk-1; smk1; serine/threonine-protein phosphatase 4 regulatory subunit 3A; SMEK homolog 1, suppressor of mek1; protein phosphatase 4 regulatory subunit 3A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgacacccggcggcgggtgaaggtgtacacgctcaacgaggaccggcagtgggacgaccggggcaccgggcatgtgtcgtctggctacgtggagcggctgaagggcatgtccctgcttgtcagggctgagagcgacggttctctacttttagagtcgaaaataaatcctaacactgcataccagaaacaacaggaagatgaaaaatttctgacagatttgtttgcacaactaacagatgaagcaacagatgaggaaaaaagacaggaattggttaactttttaaaagaattttgtgcgttttcccaaacgctacagcctcaaaacagagatgcttttttcaagactttgtcaaacatgggcatattaccagctttagaagtcatccttggcatggatgatacacaggtgcgaagtgctgctactgatatattctcatacttggttgaatataatccatccatggtacgagagtttgtcatgcaggaggcacaacagaatgatgatgtaagtaagaagttaacagagcaaaaaataaccagcaaggatattttgctcatcaacctcattatagaacatatgatttgtgatacagatcctgaacttggaggagcagtccagcttatgggcctgcttcgaactttagttgacccagagaacatgctagccactgccaataaaacagaaaagactgaatttctgggtttcttctacaagcactgtatgcatgttctcactgctcctttactagcaaatacaacagaagacaaacctagtaaagatgattttcagactgcccaactattggcacttgtattggaattgttaacattttgtgtggagcaccatacctaccacataaagaactacattattaataaggatatcctccggagagtgctagttcttatggcctcgaagcatgctttcttggcattatgtgcccttcgttttaaaagaaagattattggattaaaagatgagttttacaaccgctacataatgaaaagttttttgtttgaaccagtagtgaaagcatttctcaacaatggatcccgctacaatctgatgaactctgccataatagagatgtttgaatttattagagtggaagatataaaatcattaactgctcatgtaattgaaaattactggaaagcactggaagatgtagattatgtacagacatttaaaggattaaaactgagatttgaacaacaaagagaaaggcaagataatcccaaacttgacagtatgcgttccattttgaggaatcacagatatcgaagagatgccagaacactagaagatgaagaagagatgtggtttaacacagatgaagatgacatggaagatggagaagctgtagtgtctccatctgacaaaactaaaaatgatgatgatattatggatccaataagtaaattcatggaaaggaagaaattaaaagaaagtgaggaaaaggaagtgcttctgaaaacaaacctttctggacggcagagcccaagtttcaagctttccctgtccagtggaacgaagactaacctcaccagccagtcatctacaacaaatctgcctggttctccgggatcacctggatccccaggatctccaggctctcctggatccgtacctaaaaatacatctcagacggcagctattactacaaagggaggcctcgtgggtctggtagattatcctgatgatgatgaagatgatgatgaggatgaagataaggaagatacgttaccattgtcaaagaaagcaaaatttgattcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - E74-like factor 1 (ets domain transcription factor)
- Rho guanine nucleotide exchange factor (GEF) 10
- procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
- signal transducer and activator of transcription 4