PTPRN-protein tyrosine phosphatase, receptor type, N Gene View larger

PTPRN-protein tyrosine phosphatase, receptor type, N Gene


New product

Data sheet of PTPRN-protein tyrosine phosphatase, receptor type, N Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTPRN-protein tyrosine phosphatase, receptor type, N Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007713
Product type: DNA & cDNA
Ncbi symbol: PTPRN
Origin species: Human
Product name: PTPRN-protein tyrosine phosphatase, receptor type, N Gene
Size: 2ug
Accessions: BC007713
Gene id: 5798
Gene description: protein tyrosine phosphatase, receptor type, N
Synonyms: IA-2; IA-2/PTP; IA2; ICA512; R-PTP-N; receptor-type tyrosine-protein phosphatase-like N; ICA 512; PTP IA-2; islet cell antigen 2; islet cell antigen 512; islet cell autoantigen 3; protein tyrosine phosphatase-like N; protein tyrosine phosphatase, receptor type N
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggggccggtggagggcagagacacagcagagcttccagcccgcacatcccccatgcctggacaccccactgccagccctacctccagtgaagtccagcaggtgccaagccctgtctcctctgagcctcccaaagctgccagaccccctgtgacacctgtcctgctagagaagaaaagcccactgggccagagccagcccacggtggcaggacagccctcagcccgcccagcagcagaggaatatggctacatcgtcactgatcagaagcccctgagcctggctgcaggagtgaagctgctggagatcctggctgagcatgtgcacatgtcctcaggcagcttcatcaacatcagtgtggtgggaccagccctcaccttccgcatccggcacaatgagcagaacctgtctttggctgatgtgacccaacaagcagggctggtgaagtctgaactggaagcacagacagggctccaaatcttgcagacaggagtgggacagagggaggaggcagctgcagtccttccccaaactgcgcacagcacctcacccatgcgctcagtgctgctcactctggtggccctggcaggtgtggctgggctgctggtggctctggctgtggctctgtgtgtgcggcagcatgcgcggcagcaagacaaggagcgcctggcagccctggggcctgagggggcccatggtgacactacctttgagtaccaggacctgtgccgccagcacatggccacgaagtccttgttcaaccgggcagagggtccaccggagccttcacgggtgagcagtgtgtcctcccagttcagcgacgcagcccaggccagccccagctcccacagcagcaccccgtcctggtgcgaggagccggcccaagccaacatggacatctccacgggacacatgattctggcatacatggaggatcacctgcggaaccgggaccgccttgccaaggagtggcaggccctctgtgcctaccaagcagagccaaacacctgtgccaccgcgcagggggagggcaacatcaaaaagaaccggcatcctgacttcctgccctatgaccatgcccgcataaaactgaaggtggagagcagcccttctcggagcgattacatcaacgccagccccattattgagcatgaccctcggatgccagcctacatagccacgcagggcccgctgtcccataccatcgcagacttctggcagatggtgtgggagagcggctgcaccgtcatcgtcatgctgaccccgctggtggaggatggtgtcaagcagtgtgaccgctactggccagatgagggtgcctccctctaccacgtatatgaggtgaacctggtgtcggagcacatctggtgcgaggactttctggtgcggagcttctacctgaagaacgtgcagacccaggagacgcgcacgctcacgcagttccacttcctcagctggccggcagagggcacaccggcctccacgcggcccctgctggacttccgcaggaaggtgaacaagtgctaccggggccgctcctgccccatcatcgtgcactgcagtgatggtgcggggaggaccggcacctacatcctcatcgacatggtcctgaaccgcatggcaaaaggagtgaaggagattgacatcgctgccaccctggagcatgtccgtgaccagcggcctggccttgtccgctctaaggaccagtttgaatttgccctgacagccgtggcggaggaagtgaatgccatcctcaaggccctgccccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transposon-derived Buster3 transposase-like
- vacuolar protein sorting 33 homolog B (yeast)
- bromodomain adjacent to zinc finger domain, 2B
- acyl-CoA synthetase bubblegum family member 2

Buy PTPRN-protein tyrosine phosphatase, receptor type, N Gene now

Add to cart