KPNA6-karyopherin alpha 6 (importin alpha 7) Gene View larger

KPNA6-karyopherin alpha 6 (importin alpha 7) Gene


New product

Data sheet of KPNA6-karyopherin alpha 6 (importin alpha 7) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KPNA6-karyopherin alpha 6 (importin alpha 7) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020520
Product type: DNA & cDNA
Ncbi symbol: KPNA6
Origin species: Human
Product name: KPNA6-karyopherin alpha 6 (importin alpha 7) Gene
Size: 2ug
Accessions: BC020520
Gene id: 23633
Gene description: karyopherin alpha 6 (importin alpha 7)
Synonyms: IPOA7; KPNA7; importin subunit alpha-7; importin alpha 7 subunit; importin-alpha-S2; karyopherin alpha 6 (importin alpha 7); karyopherin subunit alpha 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaccatggcgagcccagggaaagacaattatcgaatgaagagctataagaacaatgctctaaaccctgaagaaatgagacgaagaagagaggaagagggcattcagctccggaagcagaagcgagagcaacaactttttaaacggagaaatgtggagctgattaatgaagaagctgccatgttcgatagtcttctcatggactcttatgtgagctctaccactggggagagtgtgatcacaagagagatggtggagatgctcttttctgatgattctgacctgcagttagcaaccacacagaaattccggaaactgctctccaaagagcctagtcctccaatagatgaagttatcaacactccaagagtggtggatcggttcgtggagtttctgaagaggaatgagaattgtacattacagtttgaagctgcctgggctctaacgaatattgcctctggaacctctcagcagaccaaaattgtcattgaagcaggggctgtccccatttttatagagctgcttaattcagactttgaggatgttcaggaacaggcagtctgggcactgggaaacatagctggagatagctctgtttgccgagattacgtcttgaactgttccatccttaatcctttgttaacactccttaccaagtccacacgactgacgatgacacggaatgcagtctgggccctgtcaaatctctgccgagggaaaaacccacccccagagtttgcaaaggtctctccttgtttgcctgtactgtctcgcctactcttcagcagcgactcggacttgctggcagatgcttgctgggccctttcttatctgtctgatggccccaatgagaagatccaggcagtcatagactccggagtctgccggagattggtagagctgctgatgcacaatgattacaaagtggcttctcctgccctgagagccgtgggtaacatcgtcactggggatgacatccagacccaggtcattcttaactgttcagccctaccttgccttctccacttgttgagcagtcccaaggagtcaatccggaaggaagcttgctggactatttcaaatattactgctggcaacagggctcaaatacaggctgttatagatgcaaatatcttccctgtgttgatcgaaatccttcagaaagcagagtttcgtacaaggaaagaggcagcctgggccatcaccaatgccacatcaggaggaacccctgagcagatcaggtacctggtctcactgggctgcatcaaacccctatgtgacttgctgactgtaatggattcgaagattgtgcaagtggccctcaatggactggagaacatcctgcggcttggagagcaagagggcaagcgcagtggctcaggggtcaatccttattgtggcctcatagaggaagcctatggcttggataaaattgagtttctccagagccacgagaaccaggagatctaccagaaggccttcgacctcattgagcactactttggtgtagaagacgatgatagcagcctggctccccaagtcgatgaaacgcaacagcagttcatcttccagcagcctgaggcccccatggagggcttccagctataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 22, member 17
- FYVE, RhoGEF and PH domain containing 5
- chromosome 17 open reading frame 63
- protein inhibitor of activated STAT, 2

Buy KPNA6-karyopherin alpha 6 (importin alpha 7) Gene now

Add to cart