L3MBTL4-l(3)mbt-like 4 (Drosophila) Gene View larger

L3MBTL4-l(3)mbt-like 4 (Drosophila) Gene


New product

Data sheet of L3MBTL4-l(3)mbt-like 4 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about L3MBTL4-l(3)mbt-like 4 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039316
Product type: DNA & cDNA
Ncbi symbol: L3MBTL4
Origin species: Human
Product name: L3MBTL4-l(3)mbt-like 4 (Drosophila) Gene
Size: 2ug
Accessions: BC039316
Gene id: 91133
Gene description: l(3)mbt-like 4 (Drosophila)
Synonyms: HsT1031; lethal(3)malignant brain tumor-like protein 4; H-l(3)mbt-like protein 4; L3mbt-like 4; l(3)mbt-like protein 4; l(3)mbt-like 4 (Drosophila)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacagcccaacaggaaaaggaagcttaatatggattccaaagagcgtttggatcaggacggacgcttggagcaagctgaagaggaaaagaagcccaaggatagcacaacccctttgagtcacgtcccttcagcggctgcacagggagcatggtcttgggagtggtacttgaaagaacagaaggctgtcgcagcacctgttgagctgttttccaaggatcagtcctttccagagcatgaaaatggttttcagattggaatgagattagaaggcattgatccccgacatccatcggtattctgtgtgctttctgtagcggaggtttgtggttaccgtctaagacttcattttgatggttatttaagttgctatgatttttggaccaatgctggttcccctgacattcatccagtaggatggtgtgaaaagaccaaacatgaactgcacatccctaagggttatagaaaagataaatttgtttggatggattacttgaaggcctgcaaattgcaaaatgctccaaagaaattattcagaaacagaagtcctaatgggccaatgtctaaagaatttcaggttggaatgaagctggaggccgtggacaggaagaacccttccttggtgtgtgtggcgaccatagcagatattgttgaagatcgcttactagtgcattttgacaactgggatgatagttacgattactggtgcgatgttaatagcccttatgtccagccagttggttggtgtcaggagaatggaagaactctgatagcaccccaaggttatcccaatccagaaaatttttcctggacagaatacctggaagctactcaaaccaatgcagttcctgccaaagtttttaaaatgaggttgcctcatggttttctgccaaatatgaaacttgaagttgtggataaacggaaccccaggttaattcgtgttgctacgattgtagatgttgatgaccaaagagtaaaggttcattttgatggttgggaccataagtatgactactgggtggaggcagacagccctgatatccacccgatcggatggtgtgatgtcacagggcatccactggaagtgccacagcgaacgaatgacctgaagatccttccaggtcaagctgtctgtcctactcccgggtgccgaggaataggccatatccgtggtccacgttattcgggacatcacagtgcttttggctgcccgtattcagacatgaacttgaaaaaggaggcaacacttcacgatcgtttgagagaacaaacacaggcaaatttggaatcagactcttcacattcaaaatcaaaaagcctctgtagtttgaacttcaatggaaaacatgaaaaggtgaacagtcagcccagacttgtacagcaggcaaagtgtttgaaaatcaaaggaaaagaagatattgacttggataatctcttcagaggccgagtgcggtggctcatgcctgtaatcccagcactttgggaggccgaggcaggcagatcacgagatcaggagatcaagaccatcctggccaacgcagtgaaaccccgtctctaccaaaaatacaaaaaattagccaggcgtggtggcgggtgcctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tripartite motif-containing 9
- TNFAIP3 interacting protein 1
- TNFAIP3 interacting protein 1
- tripartite motif-containing 2