CCDC9-coiled-coil domain containing 9 Gene View larger

CCDC9-coiled-coil domain containing 9 Gene

PTXBC002787

New product

Data sheet of CCDC9-coiled-coil domain containing 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC9-coiled-coil domain containing 9 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC002787
Product type: DNA & cDNA
Ncbi symbol: CCDC9
Origin species: Human
Product name: CCDC9-coiled-coil domain containing 9 Gene
Size: 2ug
Accessions: BC002787
Gene id: 26093
Gene description: coiled-coil domain containing 9
Synonyms: coiled-coil domain-containing protein 9; coiled-coil domain containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagccacactcgatttgaaatcaaaggaggagaaggatgctgagttggacaagaggatcgaggctcttcggcggaagaatgaggccctcatccggcgctaccaggagattgaggaagaccgtaagaaagctgaacttgagggagtcgcagtcacagctccccgaaagggccgctcagtggagaaggagaacgtggcagtggagtcggagaagaacctgggtccttcccggaggtctcctgggacccctcggcccccaggggccagcaaggggggccggactcctccacagcagggaggccgggccggcatgggccgagcatcgcgcagctgggagggcagccccggggagcagcctcgaggaggaggagctgggggccgtggccggaggggccggggccgaggttcacctcacctctctggagctggagacacctcaatctctgaccgtaaatccaaggagtgggaggagcggcgcaggcagaacattgagaagatgaatgaggagatggagaagatcgccgagtatgagcgcaaccagcgggaaggggttcttgaacccaacccagtgcggaacttcctggacgacccccggcgacgcagcgggcccctggaggagtctgagcgggaccgccgggaggagagccgccggcacggccgcaactgggggggccccgacttcgagcgggtgcgctgtggccttgagcacgagcggcagggccgccgagctggcctgggcagtgctggagacatgacgttgtccatgacgggccgggagcggtcggagtacctgcgctggaagcaggagagggagaagatcgaccaggagcggctgcagaggcaccgcaagcccactggccagtggaggcgcgagtgggatgccgagaagaccgatgggatgttcaaggatggcccagtccctgcccatgaaccatcccaccgctatgatgaccaggcctgggcccggcccccgaagccccctacttttggggagttcctgtcccagcacaaagctgaggccagcagccgcagaaggagaaagagcagtcggccccaggccaaggcagcgcccagggcctacagtgaccatgatgaccgctgggagacaaaagaaggggcagcatccccagcccctgagactccacagcctacttcccccgagacttcccccaaggagacacccatgcagccacccgagatcccagctcctgcccaccggcctcctgaagacgagggggaagagaatgagggggaagaggatgaagaatgggaggacataagtgaggatgaggaagaggaggagatcgaggtggaagaaggtgatgaggaggaaccagcccaagaccaccaagccccagaggctgcccccaccgggatcccctgcagtgagcaggcccacggagtccccttcagtccggaggagcccctgctggagccccaggcccctggcacgccttccagccctttctcaccacccagcggccaccagcctgtgtccgattggggtgaagaggtggagctgaattctccccggaccactcacctggctggcgccctctccccgggtgaggcctggccttttgagagtgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tripartite motif-containing 26
- tripartite motif-containing 41
- TBC1 domain family, member 23
- spermatogenesis associated 16

Buy CCDC9-coiled-coil domain containing 9 Gene now

Add to cart